AGO2 Immunoprecipitation

Cells (3 × 10⁷) were suspended in 3 ml of ice-cold hypotonic buffer (10 mm Tris (pH 7.5), 10 mm KCl, 2 mm MgCl₂, 1 mm DTT, 100 units/ml RNase OUT, and protease inhibitor mixture) for 15 min. The cytoplasmic fraction was isolated by homogenization with a Dounce homogenizer and centrifugation at 14,000 × g at 4 °C for 10 min and incubated with control IgGκ (5 μg of Ab/mg of lysate) and anti-mouse IgG-coated magnetic beads for 1 h to eliminate nonspecific binding. The precleaned lysates were then mixed with mouse anti-human Ago2 (5 μg of Ab/mg of lysate; clone 2E12-1C9, Abnova (Taipei City, Taiwan)) and anti-mouse IgG-coated magnetic beads. After incubation overnight at 4 °C on a rocking platform, AGO2-IP beads were washed twice with ice-cold wash buffer (hypotonic buffer supplemented with 150 mm NaCl and 0.5% Nonidet P-40) and once with high salt buffer (hypotonic buffer supplemented with 400 mm NaCl and 0.5% Nonidet P-40). RNA and protein were extracted from the AGO2-IP complexes using TRIzol (Invitrogen) and Laemmli buffer, respectively.

Quantitation of mRNA, miRNA, and pri-miRNA Expression Using qPCR

Total RNA was converted to cDNA by using iScript cDNA synthesis kits (Bio-Rad) or the NCode^TM miRNA First-Strand cDNA Synthesis Kit (Life Technologies) for mRNA or miRNA detection, respectively. qPCR was performed on the CFX96^TM Real-Time PCR Detection System using SYBR Green supermix (Bio-Rad). Expression data of mRNA and miRNA were normalized to GAPDH and U6 snRNA, respectively, using the 2^−ΔΔC_T method, and presented as mean ± S.E. (n = 3). qPCR primers were obtained from PrimerBank or designed using Primer3Plus (35, 36). The expression levels of Pri-miRNA were examined by using TaqMan Pri-miRNA assays according to the manufacturer's instructions (Invitrogen).

Immunoblotting

Protein extracts were resolved in SDS-PAGE, transferred to PVDF membrane, and immunoblotted with the indicated antibodies. Antibodies for DROSHA, MAP1LC3, and GAPDH were from Cell Signaling Technologies (Boston, MA), and AGO2 was from Abnova.

Microarray Analysis

The purified RNA samples from whole cells (input RNA) and AGO2-IP were submitted to the University of Tennessee Health Science Center Center of Genomics and Bioinformatics (Memphis, TN) for labeling and hybridization to HT-12 expression BeadChips (Illumina Inc.). Three independent AGO2-IP experiments were performed. Hybridization signals were processed (annotation, background subtraction, quantile normalization, and presence call filtering) using Illumina Genome Studio software (Illumina). AGO2-IP-enriched mRNAs were identified using Genespring GX version 9.0 (Agilent Technologies Inc., Santa Clara, CA) with the following cut-offs: false discovery rate = 0.1 (AGO2-IP versus input, n = 3), -fold enrichment (AGO2-IP versus input) ≥ 1.5 in more than 2 of 3 experiments. Functional annotation and pathway mapping of the AGO2-IP mRNAs were performed by Ingenuity pathway analysis (Ingenuity Systems, Inc., Redwood City, CA). The microarray data can be found in the Gene Expression Omnibus database with accession number of {"type":"entrez-geo","attrs":{"text":"GSE48162","term_id":"48162","extlink":"1"}}GSE48162.

Apoptosis Assays

To induce anoikis, cells (5 × 10⁴/well) were seeded in 6-well dishes coated with polyHEMA (Sigma) to prevent cell attachment. To induce endoplasmic reticulum stress, cells were treated with thapsigargin (50 nm). For glucose depletion, cells were seeded in growth medium overnight, washed with PBS twice, and cultured in glucose-free medium for 16 h. The glucose-free medium consists of DMEM (without glucose; Life Technologies), 5% dialyzed FBS (Life Technologies), and 100 units/ml penicillin-streptomycin. Apoptotic cells with compromised membrane integrity were detected with YO-PRO-1 dye according to the manufacturer's instructions (Life Technologies), followed by flow cytometer analysis.

Transient Transfection and Luciferase Reporter Assay

CMV-d2eGFP-21 (miR-21 sponge), CMV-d2eGFP-empty (vector control for miR-21 sponge) and pCMV-luc-miR21 (luciferase reporter with miR-21 target sites have been characterized previously (Addgene 21927, 26164, and 20876) (37). To examine the efficiency of the miR-21 sponge to inhibit miR-21 function, MDA-MB-231 cells were transfected with pCMV-luc-miR21, along with CMV-β-galactosidase and various doses of CMV-d2eGFP-21 or vector control, using Lipofectamine 2000 (Life Technologies). Luciferase and β-galactosidase activities were measured 48 h after transfection using the luciferase and β-galactosidase assay system, respectively (Promega, Madison, WI). Luciferase activity was normalized to β-galactosidase activity and expressed as mean ± S.E. (n = 6). To examine the effect of miR-21 inhibition on interaction between AGO2 and miR-21 targets, MDA-MB-231 cells (1 × 10⁷) were transfected with 15 μg of CMV-d2eGFP-21 or empty vector using Lipofectamine 2000, followed by AGO2-IP 48 h after transfection. RNA samples prepared from whole cells and AGO2-IP were subjected to qPCR analysis. To examine the effect of miRNA inhibition on mRNA expression, cells (4 × 10⁵) were transfected with 50 nm miRCURY LNA miRNA inhibitor (Exiqon) or a control oligonucleotide using Lipofectamine RNAiMAX (Invitrogen). Total RNA was prepared 48 h after transfection and subjected to qPCR analysis. The sequences of the miRNA inhibitors for miR-221 and miR-200a are AACCCAGCAGACAATGTAGC and CATCGTTACCAGACAGTGTT, respectively.

Migration and Invasion Assays

Cells (20,000 cells/0.5 ml/well) were plated onto control membrane inserts with 8-μm pores or Matrigel-coated membrane inserts (BD Biosciences), which are placed in 24-well chambers filled with 0.6 ml of growth medium. Twenty-four hours after plating, cells that remained on the upper surface of the membrane were removed by cotton-tipped swabs, and cells that migrated/invaded to the lower surface of the membrane were fixed with methanol, stained with 0.5% crystal violet, and counted under a microscope. The percent invasion was expressed as follows: % invasion = (mean number of cells invading through Matrigel insert membrane × 100)/mean number of cells migrating through control insert membrane.

Orthotopic Xenograft Model and Lung Metastasis

All animal studies adhered to protocols approved by the Institutional Animal Care and Use Committee of the University of Tennessee Health Science Center. Cells (7.5 × 10⁵ cells in 10 μl of PBS) were surgically inoculated into the right inguinal mammary gland fat pads of 4-week-old female NSG mice (NOD.Cg Prkdcscid Il2rgtm1Wjl/SzJ, The Jackson Laboratory). Mice were inspected weekly for tumor appearance by visual observation and palpation. Primary tumor outgrowth was monitored twice a week using digital calipers. Tumor volume was calculated as follows: volume = (width² × length)/2. Tumor and lung tissues were extracted 7 weeks after inoculation. The left lung lobes were fixed with 4% paraformaldehyde and subjected to tissue section (10 μm) and H&E staining. Genomic DNA from lung tissues (∼20 mg from the right lung lobes) was prepared using the Wizard Genomic DNA Purification Kit (Promega) and subjected to qPCR analysis using primers specific for the human Alu sequences (forward, 5′-ACG CCTGTAATCCCAGCACTT-3′; reverse, 5′-TCGCCCAGGCTGGAGTGCA-3′) (38).

Identification of Signaling Pathways Targeted by miRNAs

To understand the physiological role of these miRNA targets, we performed functional enrichment analysis of Ago2-IP mRNAs by using the Ingenuity pathway analysis system (Ingenuity Systems, Inc.). The signaling pathways and cellular functions commonly regulated by miRNAs in both MCF7 and MDA-MB-231 cells included cell cycle, apoptosis, adhesion/migration/invasion, lipid metabolism, stress response (e.g. ATM, autophagy, endoplasmic reticulum stress, hypoxia, and mitochondrial dysfunction), and transmembrane receptor signaling (e.g. notch, ephrin, and tumor necrosis factor) (Fig. 1C, right). Several signaling pathways critical for luminal phenotype of breast cancer were found to be targeted by miRNAs in MCF7, including nuclear receptor (e.g. signaling pathways mediated by estrogen, androgen, and retinoic acid receptor receptors), HER-2, and p53 signaling pathways. In contrast, the Wnt/β-catenin signaling pathway that confers phenotypic plasticity to basal-like breast cancer cells was targeted by miRNAs in MDA-MB-231 cells (39). These results provide an overview of signaling pathways targeted by miRNA in luminal and basal-like breast cancer cells, suggesting that miRNAs play an important role in regulating cell response to extracellular stimuli and transmembrane receptor-mediated cell-cell communications.

Validation of AGO2-IP mRNAs as Bona Fide miRNA Targets

To validate that the identified AGO2-mRNA interactions were indeed mediated by miRNAs, we examined the effect of miR-21 inhibition on mRNA-AGO2 interaction in MDA-MB-231 cells. A construct (CMV-d2eGFP-21) that expresses a sponge RNA with multiple target sites complementary to miR-21 was used to inhibit miR-21 function (37). The efficiency of miR-21 sponge to inhibit miR-21 activity was monitored by expression of a luciferase indicator (pCMV-luc-miR21) that harbors four copies of miR-21 target sites in the 3′-UTR (40). In transiently transfected MDA-MB-231 cells, miR-21 sponge increased the expression of the luciferase indicator in a dose-dependent manner (Fig. 2A) but showed no significant effect on the expression of a control luciferase reporter (data not shown). Next, we examined the effect of miR-21 sponge on AGO2 interaction of a panel of established miR-21 targets. As shown in Fig. 2B, miR-21 sponge significantly decreased the amount of miR-21 targets detected in AGO2-IP from MDA-MB-231 cells, including BTG2, COL4A1, DCUN1D3, EIF4EBP2, EPHA4, JAG1, SPRY4, and ZCCHC3.

Open in a separate window

FIGURE 2.

miR-21 sponge inhibits AGO2 association of miR-21 targets in MDA-MB-231 cells. A, a luciferase reporter that harbors miR-21 target sites in the 3′-UTR was used to monitor the efficiency of miR-21 inhibition by sponge mRNA. B, enrichment of mRNAs by AGO2-IP in the absence (black bars) and presence (gray bars) of miR-21 sponge. The results are presented as mean ± S.E. (error bars) (n = 3). *, p < 0.05 (Student's t test). C, increased expression of miR-221 targets in MDA-MB-231 cells transfected with miRCURY LNA miR-221 inhibitor. D, increased expression of miR-200a targets in MCF7 cells transfected with miRCURY LNA miR-200a inhibitor. The results were presented as mean -fold change (miRNA inhibitor versus control oligonucleotide) ± S.E. (n = 3). EV, empty vector.

In addition, we examined the effect of miRNA inhibition on the expression of cell type-specific AGO2-IP mRNAs by using LNA-modified antisense oligonucleotides for miR-221 and miR-200a, which represent cell line-specific miRNAs that are highly expressed in MDA-MB-231 and MCF7, respectively. As shown in Fig. 2C, miR-221 inhibition in MDA-MB-231 cells increased the expression of a panel of miR-221 targets that were specifically detected in AGO2-IP from MDA-MB-231 cells. The expression of these mRNAs was not significantly affected by anti-miR-221 in MCF7 cells (data not shown). Conversely, miR-200a inhibition in MCF7 cells increased the expression of a panel of miR-200a targets that were specifically found in AGO2-IP from MCF7 (Fig. 2D). The expression of these genes was not significantly affected by miR-200a inhibition in MDA-MB-231 (data not shown). Collectively, these results suggest that the AGO2-IP mRNAs are likely targets of endogenous miRNAs.

DROSHA Knockdown Increases Expression of AGO2-IP mRNAs

mRNA destabilization is closely correlated with translation suppression by miRNAs (1). Therefore, we speculated that blocking DROSHA-mediated miRNA synthesis would result in the accumulation of AGO2-IP mRNAs if they are bona fide miRNA targets. To knockdown DROSHA, cells were stably transduced with a lentiviral construct (pSicoR-Drosha1) that expresses DROSHA-specific shRNA (34). Immunoblotting and qPCR showed that DROSHA expression was reduced by ∼80% at both the mRNA and protein level in MDA-MB-231 cells expressing the shRNA (designated as DROSHA-KD) compared with control cells that were transduced with a lentiviral construct expressing scramble RNA (designed as MDA-MB-231/C) (Fig. 3A). Because MCF7 showed modest DROSHA knockdown efficiency (∼50%), the following studies were conducted in MDA-MB-231 only.

Open in a separate window

FIGURE 3.

DROSHA knockdown in MDA-MB-231 cells leads to pri-miRNA accumulation and mature mRNA reduction. A, DROSHA expression levels in cells stably expressing shRNA (MDA-MB-231/DROSHA-KD) or scramble RNA (MDA-MB-231/C). DROSHA mRNA and protein levels were examined by qPCR and immunoblotting, respectively. B, -fold changes of pri-miRNAs in response to DROSHA knockdown. Pri-miRNA levels were examined by using TaqMan pri-miRNA assays. The results are presented as mean -fold change (DROSHA-KD versus control) ± S.E. (error bars) (n = 3). *, p < 0.05 (Student's t test). C, expression levels of mature miRNA in DROSHA knockdown and control (C) cells. The results are presented as mean expression levels of miRNAs (normalized to U6) ± S.E. (n = 3).

To examine the effect of DROSHA knockdown on miRNA procession, the expression levels of 13 pri-miRNAs were examined using the TaqMan Pri-miRNA assays (Invitrogen), including pri-MIRLET7D, MIR7–3HG, MIR17HG, MIR25, MIR21, MIR22HG, MIR30B, MIR30C2, MIR100HG, MIR106A, MIR125B2, MIR130A, and MIR221). DROSHA knockdown significantly increased the abundance of seven pri-miRNAs, concomitant with a decreased expression of the corresponding mature miRNAs (Fig. 3, B and C). These results demonstrated that DROSHA knockdown abolished processing of some, but not all, of the pri-miRNAs in MDA-MB-231 cells. The various effects of DROSHA knockdown on different pri-miRNAs are probably due to the presence of multiple miRNA processing pathways (41). This finding suggests that DROSHA knockdown could have cell context-dependent effects, dependent on the expression profiles of pri-miRNAs and activities of various miRNA processing pathways.

Having demonstrated that DROSHA knockdown reduced the expression of a subset of miRNAs, we examined its impact on the expression of AGO2-IP mRNAs by microarray analysis using the human HT-12 expression BeadChips. As shown in Fig. 4, the expression levels of the vast majority of AGO2-IP mRNAs (>70%) were increased by DROSHA knockdown. Similarly, the specific increase in expression levels of AGO2-IP mRNAs was also observed in MDA-MB-231 cells with DICER1 knockdown (data not shown and {"type":"entrez-geo","attrs":{"text":"GSE48162","term_id":"48162"}}GSE48162). Taken together, these results support the conclusion that the AGO2-IP mRNAs are bona fide miRNA targets.

Open in a separate window

FIGURE 4.

DROSHA knockdown in MDA-MB-231 cells increases expression levels of putative miRNA targets identified by AGO2-IP. A, -fold change of individual mRNAs in response to DROSHA knockdown. Gene expression was examined by array analysis using Illumina HT-12 expression BeadChips. B, box plots of expression levels of putative miRNA targets and non-miRNA targets. The box shows the 25th to 75th percentile with a line at the median. C, control. Error bars, S.D.

The Majority of AGO2-IP mRNAs Are Putative Targets of Abundantly Expressed miRNAs

Next, we examined the relationship between AGO2-IP mRNAs and putative targets of miRNAs that are abundantly expressed in MCF7 and MDA-MB-231 cells. miRNA expression in MCF7 and MDA-MB-231 cells has been extensively studied, and several global miRNA expression data sets are publicly available (see the ArrayExpress, Gene Expression Omnibus, and the Cell Catalogue of Somatic Mutations in Cancer web sites). The reported expression levels of individual miRNAs appear to vary greatly among these data sets, presumably due differences in RNA sample processing and the platforms used for miRNA profiling. To compile a reliable list of abundantly expressed miRNAs in these two cell lines, we performed a meta-analysis of a total of seven data sets, as indicated in Fig. 5A. The expression levels of individual miRNAs in each data set were ranked according to Z scores (42), and the average Z scores of seven data sets were used to identify the 50 most abundantly expressed miRNAs in each cell line. The relative expression levels of these miRNAs were presented in Fig. 5A, among which 35 miRNAs exhibited comparable expression levels in both cell lines (Group C), whereas 28 miRNAs were differentially expressed (Groups A and B).

Open in a separate window

FIGURE 5.

Identification of the 50 most abundantly expressed miRNAs in MCF7 and MDA-MB-231 cells. A, heat map of miRNAs abundantly expressed in MCF7 and MDA-MB-231 cells. The relative expression levels miRNA were calculated according to Z scores from seven publicly available data sets. B, relative miRNA levels detected in AGO2-IP from MCF7 and MDA-MB-231 cells. The results are presented as mean ± S.E. (error bars) (n = 3).

Among the abundantly expressed miRNAs grouped in Fig. 5A, ∼50% of the miRNAs in each group were randomly chosen to examine their association with AGO2 in MCF7 and MDA-MB-231 cells. As shown in Fig. 5B, 27 miRNAs were detected in AGO2-IP. The relative abundance of the 27 miRNAs detected in AGO2-IP from MCF7 and MDA-MB-231 cells was consistent with the result from meta-analysis of their overall expression levels. For example, higher levels of Group A miRNAs were detected in AGO2-IP from MCF7 than in that from MDA-MB-231, whereas higher levels of Group B miRNAs were detected in AGO2-IP from MDA-MB-231 than in that from MCF7. This result suggests that AGO2 binding is well correlated with the expression levels of most miRNAs.

These abundantly expressed miRNAs in MCF7 (Groups A and C in Fig. 5A) and MDA-MB-231 (Groups B and C in Fig. 5A) harbor a total of 35 different seed sequences (Table 1). The putative targets of these miRNAs were identified by using the miRNA Target Filter of the Ingenuity pathway analysis system based on 3′-UTR sequences of mRNAs. As summarized in Table 2, over 60% of AGO2-IP mRNAs were predicted targets of the abundantly expressed miRNAs in corresponding cells. Compared with all expressed genes detected in the input RNA samples, the predicted miRNA targets were significantly overrepresented in AGO2-IP mRNAs (p < 0.05, χ² test with Yates correction). These results suggest that the majority of the AGO2-IP mRNAs are targets of miRNAs abundantly expressed in MCF7 and MDA-MB-231 cells. The absence of miRNA target sites in the 3′-UTRs of ∼40% AGO2-IP mRNAs could be attributed to the presence of miRNA target sites outside the 3′-UTRs, AGO2-mRNA interaction mediated by miRNAs expressed at low levels, and undefined miRNA binding sequences.

TABLE 2

Distribution of miRNA targets

Open in a separate window

*, χ² test with Yates correction, one-tailed.

**, Ref. 6, and 15–21.

Alternative Polyadenylation Contributes to Cell Type-specific AGO2 Interaction of mRNAs

Among the cell type-specific AGO2-IP mRNAs are putative targets of miRNAs commonly expressed in both MCF7 and MDA-MB-231 cells. One possible cause of this cell type-specific AGO2 binding is differential expression of mRNA isoforms with 3′-UTRs of varying lengths (43). A previous study reported that about one-third of mRNAs in various human tumor cells use alternative polyadenylation (APA) to generate multiple mRNA isoforms that differ in their 3′-UTRs (44). The usage of APA appears to be cell context-dependent, resulting in expression of cell type-specific mRNA isoforms (44–47).

To investigate whether APA plays a role in cell type-specific mRNA-miRNA interactions in breast cancer cells, we examined the expression ratio of the extended 3′-UTR regions (between the proximal and distal polyadenylation site) relative to the coding region of a panel of mRNAs. The cell type-specific AGO2-interacting mRNAs selected for this study are putative targets of miRNAs commonly expressed in both MCF7 and MDA-MB-231 cells and harbor APA sites according to the AREsite and xPAD Expression & Poly(A) Database (44, 48). As shown in Fig. 6, PTPRK, a MCF7-specific AGO2-IP mRNA, showed a higher ratio of the extended 3′-UTR relative to coding region in MCF7 than in MDA-MB-231 cells. This result suggests that an RTPRK isoform with a long 3′-UTR is preferentially produced in MCF7 cells. Conversely, PMAIP1 and MAPK6, two mRNAs that were detected in AGO2-IP specifically in MDA-MB-231 cells, exhibited a higher ratio of their extended 3′-UTRs relative to coding regions in MDA-MB-231 than in MCF7 cells. In addition, we also detected a preferential expression of the extended 3′-UTRs of SIAH1, SLC35A1, SPRY4, UBE2N, and APITD1 in MBA-MB-231 cells, where they were found to be associated with AGO2. However, 13 mRNAs (from a total of 21 examined) showed no difference in the expression of their extended 3′-UTRs, despite their differential interaction with AGO2, which included CCDC25, CLASP1, DGCR8, FXR1, MMD, PRKRA, RUNX1, TARBP2, TFDP1, TRAM2, UBE2N, XPO5, and ZCCHC11. These results suggest that APA accounts for the cell type-specific miRNA interaction of some, but not all, mRNAs.

Open in a separate window

FIGURE 6.

Alternative polyadenylation contributes to cell type-specific AGO2-interaction of mRNAs. The left panel shows the presence of alternative polyadenylation sites (red arrows) in the 3′-UTRs of mRNAs. The qPCR primers used to detect the expression of the extended 3′-UTR regions (between the proximal and distal polyadenylation site) are showed as purple bars. The middle panel shows the cell type-specific interaction with AGO2 of the indicated mRNA. The right panel exhibits the expression ratio of the extended 3′-UTR region relative to the coding region of mRNAs. Error bars, S.D.

DROSHA Knockdown Increases Cell Migration and Invasion

Because genes encoding proteins involved in adhesion, migration, and invasion (Fig. 1C) were overrepresented in AGO2-IP mRNAs, we speculated that blocking miRNA processing may alter cell migration and invasion. Boyden chamber migration and invasion assays showed that DROSHA knockdown significantly enhanced migration and invasion of MDA-MB-231 cells (Fig. 7A). These observations suggest that the endogenous miRNAs of MDA-MB-231 function collectively to suppress migration and invasion.

Open in a separate window

FIGURE 7.

Global miRNA inhibition by DROSHA knockdown in MDA-MB-231 cells enhances cell migration and invasion, but promotes cell death in response to various types of stress. A, DROSHA knockdown increases cell potential for migration and invasion, which were detected by Boyden chamber assays with uncoated or Matrigel-coated membrane, respectively. The results are presented as mean number of cells/field ± S.E. (error bars) (n = 3). C, control. B, DROSHA knockdown impairs autophagy flux, indicated by the lack of response of MAP1LC3A to glucose depletion (GD) or chloroquine (CQ) treatment. In control cells with normal autophagy activity, glucose depletion induces conversion of MAP1LC3A from cytosolic (LC3A-I) to membrane-bound lipidated form (LC3A-II) due to increased autophagosome assembly, whereas chloroquine causes accumulation of LC3A-II by inhibiting autophagosome degradation by lysosome. C, DROSHA knockdown sensitizes cells to apoptosis induced by various types of stress. Apoptotic cells with compromised membrane integrity were detected with YO-PRO-1 dye, followed by flow cytometer analysis.

DROSHA Knockdown Promotes Cell Death in Response to Various Types of Stress

Genes involved in various stress signaling pathways were significantly enriched in AGO2-IP mRNAs in both MCF7 and MDA-MB-231 cells, implicating a role of miRNAs in cell damage control and adaptation. Intriguingly, among the AGO2-IP mRNAs are several critical components of the autophagy pathway (e.g. CTSL1, DDIT4, ERN1, HSPA5, IDUA, LAMTOR1, RAC3, ULK3, and VTI1B). Autophagy is a catabolic process that delivers cellular components through double-membrane vesicles (autophagosomes) to lysosomes for degradation. Autophagy plays an important role in eliminating damaged cellular components and recycling cellular materials for macromolecular and organelle biosynthesis and nutrient and energy homeostasis (49). Given the prominent cytoprotective roles of autophagy, we hypothesized that blocking miRNA processing may alter autophagy activity and consequently cell sensitivity to stress.

First, we examined the effect of DROSHA knockdown on autophagy activity by measuring the conversion of MAP1LC3A from cytosolic (LC3A-I) to membrane-bound lipidated form (LC3A-II), which correlates with autophagosome formation (50). The increase of LC3A-II could result from two opposing events, accelerated production of autophagosomes due to autophagy pathway activation or blockage of autophagosome degradation due to lysosome dysfunction. These two events can be distinguished by examining the impact of autophagy activation (e.g. nutrient starvation) and lysosome inhibition (e.g. chloroquine treatment) on LC3A-II levels. Lysosome inhibition will lead to LC3A-II accumulation in cells with base-line autophagic activity. As shown in Fig. 7B, LC3A-II was not detected in untreated control cells (MDA-MB-231/C), but it was increased by glucose depletion or chloroquine treatment. In contrast, the DROSHA-KD cells exhibited a higher base-line level of LC3A-II, which was not affected by glucose depletion or chloroquine treatment (Fig. 7B). These results suggest that DROSHA knockdown impaired autophagy flux, supporting a role of miRNAs in regulating autophagy.

Next, we examined the effect of DROSHA knockdown on cell sensitivity to stressors that are known to activate autophagy, including suspension culture (anoikis), glucose depletion, and endoplasmic reticulum stress induced by thapsigargin (49, 51–53). Apoptotic cells were detected by using YO-PRO-1 staining (Invitrogen), which labels cells with compromised membrane permeability. As shown in Fig. 7C, DROSHA knockdown significantly sensitized cells to apoptosis induced by anoikis, endoplasmic reticulum stress, and glucose depletion. Together, these results suggest that miRNAs play a protective role in tumor cells under stress by regulating autophagy flux.