The Gly-Ala repeat sequence (GAr) of EBNA1 can prevent mRNA translation initiation and MHC class I restricted antigen presentation from open reading frames (ORF) to which it is fused [19], [20]. To test to which degree the GAr is responsible for the suppression of EBNA1 antigen presentation we fused the SIINFEKL encoding antigenic peptide sequence (SL8) derived from chicken Ovalbumin (Ova) [21], [22] into the EBNA1 (EBNA1-SL8) or in an EBNA1 in which the Gly-Ala repeat (GAr) was deleted (EBNA1ΔGA-SL8) (Fig. 1A). This allowed us to monitor any effect the GAr has on antigen presentation from these mRNAs using the B3Z CD8⁺ T hybridoma that is specific for the SL8 in the context of H-2K^b MHC class I molecules [23].

H-2K^b EL4 cells expressing Ova or EBNA1ΔGA-SL8 gave a similar level of presentation of the SL8 epitope, demonstrating that there is no significant difference in how this antigen is processed and presented between these two constructs. However, presentation of SL8 in the context of EBNA1 was dramatically suppressed and comparable to cells expressing an empty vector (Fig. 1B, left graph). Similar results were obtained using the H1299 human cell line in which a vector coding the mouse H-2K^b MHC class I molecule was cotransfected together with the expression vectors for Ova, EBNA1-SL8 or EBNA1ΔGA-SL8 respectively (Fig. 1B, right graph).

To test how this difference in antigen presentation correlates with GAr's inhibitory effect on protein synthesis, H1299 cells expressing each construct were pulsed for 1 h in the presence of ³⁵S-methionine and proteasome inhibitor in order to minimize any effects of proteasomal degradation before harvested. This revealed that EBNA1-SL8 is translated with approximately 60% reduced efficiency as compared to the EBNA1ΔGA-SL8 (Fig. 1C). Western blot analysis showed that the steady state protein expressions of the respective proteins correlate with their respective rate of synthesis (Fig. 1D).

Similar results in terms of control of synthesis and antigen presentation were also obtained when the GAr sequence was fused to the N-terminus of Ova itself. Fusion of the full length GAr to the N-terminus of ovalbumin (GAr-Ova) effectively prevents the presentation of the SL8 peptide over a wide range of mRNA concentrations and eight times the amount of a GAr-Ova cDNA was required to reach the same level of antigen presentation as from cells expressing Ova alone (Fig. 1E, left panel). To ensure that the antigen presentation reporter system was not saturated under these conditions we increased the number of Ova expressing EL4 cells that were exposed to the same fixed number (5×10⁴) of B3Z cells used in the above experiments (Fig. 1E, right panel).

These results, together with previous reports, collectively support the notion that the GAr domain alone inhibits presentation of peptides to the MHC class I pathway from the EBNA1 or from any mRNA to which it is fused, irrespectively of location [19], [20].

It is known that the GAr in addition to preventing translation initiation also has the capacity to inhibit protein unfolding and proteasome-mediated degradation in a substrate- and position-dependent fashion [24]. In order to investigate if the capacity of the GAr to affect protein stability plays a role in its capacity to provide immune evasion we separated its two functions.

The SL8 was inserted in the 3′ untranslated region (UTR) of the GAr sequence, either in the same or in a different reading frame (GAr-1 and GAr-2, respectively) where it is expressed as a cryptic minigene [25], [26]. Thus, any effect the GAr has on antigen presentation from these mRNAs can be separated from its capacity to inhibit proteasomal degradation since the GAr and the SL8 epitope are expressed as separate polypeptides. We also fused the SL8 peptide in frame with the C-terminus of the GAr (GAr-3) (Fig. 2A). In addition, we made the corresponding constructs where we exchanged the GAr sequence for that of the GFP (GFP-1, GFP-2 and GFP-3 respectively) (Fig. 2A). The GFP is a suitable replacement for the GAr as it is also a protein with a low turnover rate, a poor substrate for the proteasomes [27] and, importantly, the levels of mRNAs expressing the SL8 are similar in the context of either ORF (Fig. 2B). These different constructs allowed us to compare the effect of the GAr on suppressing MHC class I antigen presentation independently of its capacity to influence protein degradation. The level of presentation of SL8 from the GFP-3 is similar to that from Ova itself, demonstrating that there is no significant difference in how the antigen is processed in these two settings. However, presentation of the SL8 in the context of all GAr-carrying mRNAs is suppressed as compared with the corresponding GFP constructs, demonstrating that the GAr prevents mRNA antigen presentation throughout the entire mRNA (Fig. 2C). The GFP-1 and GFP-2 constructs give a lower level of presentation of the SL8 compared to when fused to the C-terminus of GFP (GFP-3) (Fig. 2C). This is explained by the fact that the antigenic peptide in GFP-1 and 2 are expressed as cryptic translation products compared with when it is fused to the main reading frame in GFP-3 and Ova. To ensure that the expression of SL8 from the GFP-2 and GAr-2 minigene constructs are indeed derived from an initiation event and not from a read-through from the main ORF we substituted the AUG codon with GGC or GCC. As this completely prevented antigen expression from either constructs it shows that the expression of the SL8 is not due to a read-through event and, thus, that the GAr suppresses a reinitiating event (Fig. 2D). Western blot analysis confirms that the expression levels from the main ORF of the different constructs are similar (Fig. 2E). The notion that SL8 expressed from the 3′UTR is derived from an independent initiation event is further supported by treating cells with IFNγ. IFNγ stimulates the induction of immunoproteasomes and N-terminal trimming peptidases that together give a more efficient processing of peptides longer than 8–10 residues for loading onto MHC class I molecules [28], [29]. IFNγ treatment does not affect presentation of the SL8 when inserted in the 3′UTR, which is what is expected if it is expressed as a minigene, and only when fused directly to the C-terminus of GFP or GAr (Fig. 2F, left panel). By treating cells with the proteasome inhibitor epoxomicin we observed that that presentation of SL8 is proteasome-dependent when derived from Ova, or fused to GFP, but not when translated as an out-of-frame minigene downstream of GFP (GFP-1 &-2) (Fig. 2F, right panel) or GAr (GAr-1 &-2) (data not shown). These results show that the cryptic translated SL8 peptides are derived from independent translation initiation and do not carry additional residues from the main upstream reading frame that could interfere with the processing of the MHC class I peptide.

Taken together, these results show that the GAr suppresses the presentation of the SL8 epitope within the same reading frame and out-of-frame epitopes. Hence, the GAr suppresses MHC class I restricted antigen presentation by preventing translation initiation throughout the entire mRNA and its potential capacity to control protein stability is not required to impose immune evasion.

The nascent GAr peptide is regulating the synthesis of EBNA1 by directly blocking initiation of the EBNA1 mRNA translation in cis which is caused by a delay in the assembly of the initiation complex [19]. The molecular target of the GAr is not yet known but we have observed that insertion of the c-myc IRES [30] in the 5′UTR of GAr-Ova (c-myc-GAr-Ova) overrides GAr-dependent inhibition of protein synthesis and restores the rate of expression to approximately 70% of that of Ova alone (Figs. 3A and 3B, left panel). Similarly, the c-myc IRES also induced the expression of the GAr alone approximately 3-fold, demonstrating that this effect is restricted to the GAr itself (Fig. 3B, right panel). The c-myc IRES has no effect on the rate of Ova synthesis when inserted in an identical way in the 5′UTR (Fig. 3B, left panel), indicating its specific effect on GAr-mediated translation control. Moreover, the c-myc IRES and the GAr domain only affect mRNA translation in cis as we do not see any changes on the rate of translation of actin or of the exogenous GFP (Fig. 3C).

Thus, the combination of the GAr and the c-myc IRES provides us with tools with which we can study the relationship between the rate of mRNA translation initiation and the production of antigenic peptides from a single mRNA without targeting protein synthesis or degradation using general chemical inhibitors. When we tested the effect of the c-myc IRES on GAr-dependent control of antigen presentation we observed a 70% presentation of SL8, as compared to Ova alone or c-myc-Ova (Fig. 3D). Under the same conditions the presentation of SL8 from the GAr-Ova fusion construct was approximately 5-fold less. As the c-myc IRES does not affect the GAr-Ova ORF this result further underlines that the potential effect of the GAr to control the stability of the protein to which it is fused is not sufficient to suppress antigen presentation. Insertion of the c-myc IRES in the 5′UTR of the GAr-2 mRNAs also resulted in a sharp increase in antigen presentation, demonstrating that the same mechanism of translation initiation control that regulates the production of antigenic peptides derived from the main ORF also regulates the production peptides derived from cryptic minigenes.

The capacity of the c-myc IRES to neutralise the translation inhibitory effect of the GAr is cell specific and was observed in three out of three human cell lines tested (Table 1). However, it has been shown that the efficiency of the c-myc IRES-driven translation varies between cell lines from different origins. In murine cell lines the c-myc IRES-driven translation is much lower than in human cell lines and importantly it has been shown to be inactive in murine adult tissue [31], [32]. This explains the finding that the c-myc IRES was incapable to override the translation inhibitory effect of the GAr in all the murine cell lines tested (Table 1).

The c-myc IRES has been characterised and consists of different domains and predicted ribosome entry window (Figs. 4A and 4B). It has been shown that deletion of the domain 1 reduces its activity with about 60% [33]. In line with this, fusion of a c-myc IRES, that lacks domain 1 (Δcmyc-IRES), in the 5′UTR of Ova-GAr results in a reduced capacity to override suppression of translation and antigen presentation (Fig. 4C). This further links the effect of the c-myc IRES and its capacity to overcome GAr-dependent suppression with its capacity to control mRNA translation initiation (Fig. 4C).

These results show that GAr-mediated suppression of translation initiation is sufficient and necessary to prevent antigen presentation from the main ORF as well as from cryptic translation products and that its effect can be neutralised by alternative mechanisms of initiation provided by the c-myc IRES.

The observations that the increase in rate of synthesis after insertion of the c-myc-IRES corresponds to antigen presentation indicates a close correlation between the rate of mRNA translation initiation and the capacity of CD8⁺ T cells to detect and destroy virus-infected host cells. In order to look more closely at this relationship, we wanted to change the rate of Ova synthesis more subtly compared with the “on/off” effect obtained with the c-myc-IRES and we used mutated GAr sequences that have been shown to affect the synthesis of GAr fusion proteins. The lymphocrypto-Papio and the Rhesus viruses infect Old World primates and express EBNA1 homologues that carry shorter GAr-like sequences that have previously been shown not to prevent antigen presentation [34]. The EBV-GAr sequence consists of single alanine residues separated by one, two or three glycines while the Papio-GAr carries single serine residues inserted in every seven residues of the repeat (Fig. 5A and [19]). When we fused a 30 amino acid Papio-GAr sequence (30GAr-Papio-Ova) and a corresponding 30 amino acid EBV-GAr sequence (30GAr-EBV-Ova) to the N-terminus of Ova we observed that the Papio-GAr-like sequence had no effect on mRNA translation or antigen presentation while insertion of the corresponding EBV-GAr sequence resulted in an approximately 4-fold less synthesis and antigen presentation (Figs. 5B and 5C). Similar results were also obtained with the Rhesus GAr-like sequence which also carries serine insertions (data not shown). Interestingly, the Papio-GAr has the capacity to control protein stability and fusion of the Papio-GAr to the p53 protein, which is normally targeted for the ubiquitin-dependent degradation pathway by the MDM2 E3 ligase, resulted in a stabilisation and in an accumulation of polyubiquitinated 30GAr-Papio-p53 products in the presence of MDM2 (Fig. 5D). This indicates that while the Papio sequence retains the effect on proteins stability, the disruption of its GAr sequence is sufficient to render it inefficient in preventing antigen presentation or protein synthesis control [24].

We next tested a construct in which the GAr repeat had been disrupted by inserting two alanines next to each other on three locations (32GAr3A-Ova) (Fig. 5E). This retains the GC rich content of the GAr RNA sequence without introducing new amino acid residues. In this case, the rate of synthesis was approximately 50% less compared with Ova alone but over two-fold more efficient than that of the wild type GAr (30GAr-EBV-Ova) (Fig. 5F, left panel). If two glycine residues were instead replaced by serines (31GAr2S-Ova) we obtained a 75% translation efficiency as compared to Ova alone. When we next compared the effects of these GAr sequences on antigen presentation we observed that the rate of mRNA translation initiation is closely followed by the amount of antigens presented to the MHC class I molecules (Fig. 5F, right panel).

Taken together, these results indicate a direct and proportional relationship between endogenous antigen presentation and mRNA translation initiation control.

The murine lymphoma cell line EL4 (H-2K^b) and B3Z cell line were maintained in complete medium, consisting of RPMI-1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS), 25 mM Hepes-buffer solution (Gibco-BRL, Santa Clara, CA), 100 IU/ml penicillin and streptomycin (Gibco-BRL), 2 mM L-glutamine (Gibco-BRL), 2 mM sodium pyruvate solution (Gibco-BRL), 2 mM non-essential amino acid solution (Gibco-BRL), and 0.5 µM of 2-β mercaptoethanol (2-βME) (Sigma-Aldrich, St. Louis, MO). Transient transfections of EL4 cells were performed by electroporation using a BMX pulser Bio-Rad Gene Pulser II (Bio Rad, Hercules, CA) at 260 mV in a 0.4 cm Bio-Rad electroporation cuvette. EL4 cells were washed once in washing medium, consisting of RPMI medium 1640 supplemented with 2% heat-inactivated fetal calf serum (FCS), 25 mM Hepes-buffer solution (Gibco-BRL), 100 units/ml penicillin, and and 100 µg/ml streptomycin (Gibco-BRL), 2 mM L-glutamine (Gibco-BRL), 2 mM sodium pyruvate solution (Gibco-BRL), 2 mM non-essential amino acid solution (Gibco-BRL), and 0.5 µM of 2-βME (Sigma Chemical). The cells were then suspended in complete medium at a concentration of 7.5×10⁶/ml. 8 µg of plasmid were inoculated with 3×10⁶ cells in the electroporation cuvette. Immediately after electroporation, the cells were transferred to a 6-well plate with 3 ml of complete media. Human cell lines were cultivated under standard conditions in RPMI medium 1640 (H1299 and Saos-2), each containing 10% FCS, 2 mM L-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin. Cells were seeded in 6-well plates at a density of 1.75×10⁵ cells/well. The following day the cells were cotransfected with 1 µg total of expression plasmids along with 3 µl of Genejuice according to the manufacturer's protocol (Merck Biosciences, Darmstadt, Germany).

Following separation on 12% SDS-PAGE, proteins were transferred to 0.45 µm nitrocellulose membranes, and blots were blocked for 1 hour at room temperature with a 5% skim milk in TBS solution consisting of 20 mM Tris, 500 mM NaCl, 0.1% Tween 20, pH 7.5. Blots were incubated overnight at 4°C with anti-EBNA1 mouse monoclonal antibody (OT1X) (1∶1000) or polyclonal anti-GA antibody (1∶500), raised against the Gly-Ala sequence of EBNA1 protein or a monoclonal actin antibody (1∶1000) Chemicon International (Temecula, CA) or anti-p53 rabbit polyclonal antibody (CM-1). The membranes were washed before incubated with horseradish peroxidase-conjugated rabbit anti-mouse or mouse anti-rabbit immunoglobulin antibody (1∶5000) for another 1 h and detected using ECL (Amersham Bioscience). The ECL signal was quantified using CCD camera and associated software (Vilber Lourimat, France). Pre-stained molecular markers were from Fermenta (Ontario, Canada).

All plasmids were generated using standard procedures. Restriction enzymes, T4 DNA ligase and calf intestinal alkaline phosphatase were obtained from New England Biolabs (Ipswich, MA). Purified synthetic oligonucleotides were obtained either from MWG biotech (Ebersberg, Germany) or Eurogentec. Routine plasmid maintenance was carried out in DH5α and TOP10 bacteria strains.

The EBNA1 and EBNA1ΔGA were generated using oligonucleotide pairs 5′AGTATAATCAACTTTGAAAAACTCTGAGAAG3′ and 5′CTTCTCAGAGTTTTTCAAAGTTGATTATACT3′, encoding the SL8 peptide, inserted into the unique Bstx1 site found in EBNA1 sequence, right after the GAr sequence.

The GFP-1 construct was prepared using oligonucleotide pairs 5′AATTCTGAATGAGTATAATCAACTTTGAAAAACTCTGAT3′ and 5′CTAGATCAGAGTTTTTCAAAGTTGATTATACTCATTCAG3′, encoding the SL8 peptide, inserted into the EcoR1/Xba1 sites of EGFP-C2 vector (BD Biosciences Clontech, Palo Alto, CA). The GAr-1 construct was made using the same oligonucleotide pairs inserted in the 3′UTR of the GAr, itself cloned into the pCDNA-3 vector (Invitrogen, Carlsbad, CA). The GFP-2 and GAr-2 constructs were made in the same way using the oligonucleotide pairs 5′AATTCCTGAATGAGTATAATCAACTTTGAAAAACTCTGAT3′ and 5′CTAGATCAGAGTTTTTCAAAGTTGATTATACTCATTCAGG3′. The different GAr-2 constructs were prepared by mutating the AUG codon in GCC or GGC using standard procedures. The GFP-3 and GAr-3 constructs were prepared using the oligonucleotide pairs 5′AATTCAGTATAATCAACTTTGAAAAACTCTGAT3′and 5′CTAGATCAGAGTTTTTCAAAGTTGATTATACTG3′ and inserted in the same vectors.

The c-myc IRES cDNA was obtained from Dr. A.C. Prats (INSERM U589, France). The pCDNA3-Ova and pCDNA3-GAr-Ova constructs were obtained as described previously [20]. c-myc-Ova, c-myc-GAr-Ova and c-myc-GAr-2 were generated by amplification of full length human c-myc IRES by polymerase chain reaction (PCR), using a 5′ sense primer containing a BamH1 site 5′CGGATCCACTAGAACTCGCTGTAGTAATTC3′ and a 3′ antisense primer 5′TCCGGATCCGCGGGAGGCTGCTGG 3′ containing another BamH1 site. The fragment was cloned into the 5′UTR digested pCDNA3-Ova, pCDNA3-GAr-Ova and pCDNA3-GAr-2 constructs.

The 30GAr-EBV-Ova construct was made by replacing the full-length GAr sequence in the Gar-Ova construct with an oligonucleotide sequences corresponding to 30 amino acids of the GAr. The same approach was used to produce 32GAr3A-Ova, 31GAr2S-Ova and 30GAr-Papio-Ova.

All mRNA translation assays were carried out in H1299 cells transfected with indicated constructs. Transfected cells were cultured for 36 hours before treated with 20 µM MG132 for one hour in methionine free medium containing 2% dialysed FCS. 0.15 mCi/ml of [³⁵S] methionine (Perkin Elmer, Boston, USA) was added in the presence of proteasome inhibitor and the cells were harvested at indicated time points using a rubber policeman after 2x washing in cold PBS. Cell pellets were snap frozen at −80°C before lysed in PBS containing 1% NP40 and Complete protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) at 4°C. Lysates were centrifuged for 15 minutes at 14.000 rpm and pre-cleared by addition of mouse sera and protein G sepharose. An equal amount of total protein was incubated with specific antibodies for 4 hours at 4°C before the immune complexes were recovered using protein G sepharose. The proteins were separated on precast Bis-Tris 4–12% SDS-PAGE (Invitrogen) and the amount of labelled protein was visualized by autoradiography and the relative amount of protein synthesis was determined using phosphoimager.

EL4-Kb restricted cells (5×10⁴) expressing the indicated constructs for 48 h were washed in medium and cultured with 5×10⁴ B3Z T cell hybridoma for at least 20 h in 96-well plates. T cell assays in human H1299 cell lines were done by co-transfecting the Kb expression vector together with the reporter construct. The B3Z CD8⁺ T cell hybridoma expresses LacZ in response to activation of T cell receptors specific for the SIINFEKL peptide (OVA-immunodominant peptide) in the context of H-2K^b MHC class I molecules. The cells were then harvested and washed 2 times with 1X cold PBS prior to lysis in 0.2% TritonX-100, 0.5M K₂HPO₄, 0.5M KH₂PO₄ for 5 min on ice. The lysates were centrifuged for 10 min and 25 µl of supernatant from each well were transferred into 96-well optiplate counting plates (Packard Bioscience, Randburg, SA). The plates were incubated for 1 hour at room temperature, protected from light and tested for β-Galactosidase activity using the Luminescence assay (BD Biosciences Clontech) on a FLUOstar OPTIMA (BMG LABTECH Gmbh, Offenburg, Germany). The results were expressed in counts per seconds (CPS) or in relative light units (RLU). The peptides SIINFEKL (corresponding to ovalbumin amino acids 258–276) was purchased from Eurogentec (Seraing, Belgium).

Total RNA was isolated from EL4 cells. After separation on agarose gels, the RNA was transferred to nylon filter (Hybond-N+; Amersham Bioscience). An oligonucleotide probe corresponding to the SIINFEKL sequence was previously labelled with [³²P]ATP using the Ready-to-Go kit (Amersham Bioscience). After baking the membrane at 80°C for 2 h, the RNA was hybridized overnight with the probe at 42°C in PerfectHyb Hybridization Solution (TOYOBO, Tokyo, Japan). The membranes were washed twice for 5 min in 1× sodium chloride/sodium citrate (SSC : 0.15 M NaCl, 15 mM sodium citrate, pH 7.0) that contained 0.1% SDS at room temperature and twice for 1 h in 1×SSC that contained 0.1% SDS at 55°C. The RNA was visualized by autoradiography.