Libraries were designed based on the DSL-U5 ribozyme (15). For the construction of GAAA-loop library, whose target motif is GAAA-loop, a synthetic template DNA (Figure 1A) (DSL-GAAA-N19; 5′-AGGGAAGGAAACTTCCCTGT GTCTTTTTTGAGCCCTCAAT CCNNNNNNNN NNNNNNNNNN NGGATCAATG GGTAGGACCA TCCGTTCCCT AGCAGGGTTC-3′; where N stands for any nucleotide, and BanII site is indicated in italic) was amplified by PCR using ExTaq DNA polymerase (Takara-Bio, Japan) with forward and reverse primers (DSL-F3, 5′-TAATACGACT CACTATAAGG GAAGGAAACT TCCCTGTGTC-3′; and DSL-R2R3, 5′-TCTGCCTAAG TGGGCAATGA GACTGGAACC CTGCTAGGGA ACGG-3′, respectively. T7 promoter sequence is underlined). All oligodeoxynucleotides were purchased from Operon Biotechnologies (Japan). For the construction of a C-loop library whose target motif is the C-loop, the above GAAA-loop library was digested with the nonpalindromic restriction enzyme, BanII, and then, the 3′-fragment containing the random sequence was purified by native PAGE and precipitated with ethanol. The fragment was ligated with a synthetic, 5′-fragment containing the C-loop motif (C-50b-F1; 5′-TAATACGACT CACTATAAGG GAAAGCACTG GTTCGCCAGC TTTCCCTGTG GATTTTTGAG CC-3′, where the T7 promoter sequence and the BanII site are underlined and italicized, respectively) in the presence of a splint DNA using T4 DNA ligase (Takara-Bio). The ligated product was amplified by PCR with C-50b-F1 and DSL-R2R3 as forward and reverse primers, respectively, and the amplified full-length fragment was purified by native PAGE. The PCR product was extracted by phenol/chloroform treatment, precipitated with ethanol and transcribed using T7 RNA polymerase (RiboMAX Large Scale RNA Production System-T7, Promega, WI, USA). After in vitro transcription, the template DNA was digested by RQ1 DNase (Promega), and the transcript was extracted by phenol/chloroform treatment, followed by purification on Microcon YM-30 (Millipore, MA, USA) and MicroSpin G-25 columns (GE Healthcare, Uppsala, Sweden) to yield an RNA pool. Throughout the experiment, 1 × 10¹⁵ molecules in the RNA pool were used for the in vitro selection. Theoretically, 3.6 × 10³ copies of 2.7 × 10¹¹ (= 4¹⁹) variants are included in the initial pool. Figure 1.

Secondary structures of the parental DSL-U5 ribozyme and its derived libraries. (A) The DSL-U5 ribozyme with the GAAA-tetraloop/11-ntR pair essential for the ribozyme activity highlighted in gray. (B) The GAAA-loop library with the target GAAA-tetraloop and the randomized nucleotides highlighted in gray. (C) The C-loop library with the target C-loop motif (C-50) with neighboring single base pairs and randomized nucleotides highlighted in gray.

In vitro selection was carried out essentially as described (14). Selection conditions were in 50 mM Tris–HCl (pH 7.5), (Figure 2) 100 mM NaCl and 20 mM MgCl₂. Substrate RNAs [S-1 and S-2 (14)] were purchased from Gene Design Inc. (Japan). In order to exchange the guide sequence (complementary to the substrate RNA) of the libraries, and to eliminate undesired mutations at the nonrandomized regions, 5′-fragments of the libraries were exchanged after every third round of the selection as follows. After the first three rounds of selection from the GAAA-loop library, the 5′-fragment was exchanged with DSL-F2 (5′-TAATACGACT CACTATAAGG GAAGGAAACT TCCCTGTGGA TTTTTTGAGC C-3′. T7 promoter sequence and BanII site are underlined and italicized, respectively) as described above. After the third and sixth rounds of the selection of C-loop library, the 5′-fragment was exchanged with C-50b-F2 (5′-TAATACGACT CACTATAAGG GAAAGCACTG GTTCGCCAGC TTTCCCTGTG TCTTTTTGAG CC-3′. The T7 promoter sequence and BanII site are indicated by underline and italic, respectively) and C-50b-F1, respectively. Other conditions for the in vitro selection are listed in Table 1, and the detailed selection procedure is described in the Supplementary Data (in vitro selection protocol). Table 1

Conditions for in vitro selection

For the preparation of uniformly labeled RNAs, in vitro transcription was carried out in the presence of [alpha-³²P]-GTP. Synthetic single-stranded oligodeoxynucleotide templates annealed with a T7 promoter oligonucleotide were directly used for transcription. After RQ1 DNase treatment, phenol/chloroform extraction and ethanol precipitation, the transcripts were purified by denaturing PAGE, recovered by crush-and-soak method and precipitated with ethanol. The trace amount (0.2–0.4 nM) of the labeled RNAs and the indicated concentrations of unlabeled RNAs were folded separately. Initially, these RNAs were heated in water at 90°C for 2 min, immediately cooled on ice, followed by folding for 10 min at 37°C in the buffer employed for the in vitro selection. These separately folded, labeled and unlabeled RNAs were mixed and incubated for >30 min to form dimers. After the incubation, 1 µl of 50% glycerol was added to the 10 µl of the RNA samples, and these samples were run at 4°C on 10% polyacrylamide gels containing 50 mM Tris–borate (pH 8.2) and 20 mM MgCl₂. The RNA bands were quantified by FLA-5100 (Fujifilm Life Science, Japan). K_d values were determined as the concentration at which half the RNA molecules form dimers.

In order to label the 5′-end of RNA, unlabeled transcript was treated with alkaline phosphatase from Calf intestine (Takara-Bio) to dephosphorylate the 5′-end, followed by phosphorylation with [gamma-³²P]-ATP using T4 polynucleotide kinase (Takara-Bio). The labeled RNA was purified by denaturing PAGE as described above. The RNA folding and dimerization were carried out as described above in the presence of 50 mM HEPES-OAc (pH 7.5), 100 mM NaOAc and 20 mM Mg(OAc)₂ instead of the selection buffer. It was confirmed that the clone #05 ribozyme is also active under this buffer condition (data not shown). Lead(II)-induced cleavage analysis was carried out as described (16).

Previously, a mutational analysis of the DSL ribozyme showed that the THS motif is less important for ribozyme activity than the GAAA-loop/11-ntR pair. A miniaturized variant lacking the THS motif (DSL-U5; Figure 1A) is as active as the parental DSL ribozyme (14,15). We employed the DSL-U5 variant as a platform for our ribozyme-based selection system. We first carried out the selection of motifs targeting the GAAA-loop (Figure 2). Since there is at least one defined positive control sequence for this target, namely the 11-ntR motif, the GAAA loop is an ideal target to test our experimental design. Fifteen nucleotides constituting the 11-ntR motif as well as a capping stem–loop structure of the DSL-U5 ribozyme were replaced with 19 nt of random sequence (Figure 1B). Although two C-G base pairs adjacent to the catalytic unit are considered to be a part of the 11-ntR motif, they function to stabilize the catalytic unit structure, and thus these two base pairs were excluded from randomization.

After six rounds of the selection/amplification cycle based on ligation activity, the resulting RNA pool showed activity comparable to the parental DSL-U5 ribozyme (data not shown). Hence, we determined the sequences of clones randomly picked from the pool after round 6 of the selection (Figure 3). Out of 28 clones sequenced, 13 clones were highly similar (or even identical) to the 11-ntR motif. Fourteen additional clones were either identical, or highly similar to the previously reported C7.2 motif, which is an artificially selected receptor for the GAAA-loop (18). Together, these results demonstrate the proof-of-concept of this in vitro selection technology to generate receptor motifs against a given target RNA structure. Figure 3.

Clones obtained after the sixth round of selection from the GAAA-loop library. Consensus primary sequences and base pairings are highlighted in pink and purple, respectively. Point mutations at nonrandomized positions are indicated in red.

Next, we attempted to generate novel motifs recognizing an RNA structure whose natural receptor is completely unknown. We chose the C-loop motif from 23S rRNA of Haloarcula marismortui (C-50) as the first target (Figure 1C). The C-loop motif is a class of asymmetric internal loops that locally increases the helical twist between neighboring stems, and typically, they do not directly interact with other RNA structures (19).

To construct a library to isolate C-loop receptor motifs, the GAAA tetraloop of the GAAA-loop library was replaced with a C-loop motif with a neighboring single base pair, and the free end of the motif was capped with a UUCG tetraloop (Figure 1C). After seven rounds of selection, the ligation activity of the RNA pool was clearly detectable, suggesting restoration of ribozyme activity by binding to the new C-loop motif (Figure 4). Clones were randomly picked from the pool and their sequences determined (Table 2). Interestingly, 15 clones shared an apparent consensus sequence (underlined nucleotides in Table 2) and can be classified to three subgroups: Group 1, the major variant, consists of clone #05 (nine isolates) and its derivative clone #09; Group 2, the next frequent variant, consists of clone #10 (three clones) and its derivative clone #03; and Group 3 is clone #11. Figure 4.

Ligation reaction of the RNA pool from the C-loop library. Uniformly [³²P]-labeled RNAs from round 0 or round 7 pool were incubated with or without substrate RNA (2 µM of S-1) in the buffer employed for the in vitro selection at 37°C for 1 h. The reactions were terminated by adding sample-loading buffer (14), and these samples were separated on denaturing-PAGE. The ligated product is indicated with an arrowhead.

In order to see whether the newly isolated motifs can act as independent structural units as intended, we examined the ability to place the most abundant sequence (hereafter #05 receptor) into a different structural context. We transplanted the #05 receptor into TectoRNA, an artificial RNA architecture developed by Jaeger and colleagues (21,22), since its self-dimerization properties are suitable to examine the modularity of the selected motif. The original TectoRNA (construct 1 of ref. 22), in which the GAAA-loop/11-ntR pair was connected by a linker helix of a suitable length, forms a homodimer in a concentration-dependent manner. The dissociation constant (K_d) for the dimerization can be determined by the titration of unlabeled RNA in the presence of trace amount of labeled RNA on EMSA. Under our assay conditions, the K_d value of the original TectoRNA with GAAA-loop/11-ntR pair was 34.5 ± 3.4 nM (data not shown). The K_d value is one order of magnitude higher than that in the original report (22), probably due to the differences of EMSA conditions between Jaeger's and ours that is based on the condition employed in the in vitro selection.

First, we grafted the C-loop motif and the #05 receptor into the corresponding positions of TectoRNA (Figure 5A). EMSA of this construct showed an apparent reduction in mobility in a concentration-dependent manner (Figure 5C). The mobility of low and high concentrations of the construct was close to those of the original TectoRNA, and the degree of the mobility change is consistent with a biphasic dimerization model with typical fast exchange kinetics (R² = 0.956–0.998), suggesting that the construct dimerized, as is the case for the original TectoRNA (22). Its K_d value, determined as the kinetic equilibrium, was 168 nM (Figure 5C). Figure 5.

Electophoretic mobility shift assays (EMSA). (A and B) Secondary structures of TectoRNA-derived, homodimer-forming constructs. The UUCG tetraloop capping the end of the stem in the construct shown in (A) is eliminated in the construct shown in (B). The target C-loop and the obtained #05 receptor motifs are highlighted with gray boxes. (C and D) Respective autoradiograms of the EMSA experiments for constructs shown in (A) and (B). From left to right, 0, 50, 100, 200, 400, 800 and 1600 nM of unlabeled RNA were added.