Chromosomes in human cells are capped at both ends with (TTAGGG)n DNA arrays called telomere that is essential in maintaining chromosomal integrity and cellular viability. Due to the end-replication problem, telomere shortens during each round of DNA replication and this shortening, if continued without compensation, eventually limits the division potential of cells. Telomere length homeostasis is essential for the generation and growth of cancer. In >85% cancer cells, telomere shortening is compensated by telomerase, a ribonucleoprotein reverse transcriptase that adds telomeric repeats to telomere ends (1). Telomere DNA stretches for several thousand base pairs in double-stranded form and terminates with a single-stranded G-rich overhang that serves as a substrate for telomerase. The G-rich overhang can fold in the presence of K⁺ or Na⁺ into a four-stranded G-quadruplex (2) that is not a substrate for telomerase (3,4). Stabilization of quadruplex by small molecules has been shown to inhibit telomerase activity (5) and induce growth arrest, senescence and apoptosis in cancer cells (6). For this reason, there is currently intense interest in exploring quadruplex-stabilizing compounds to inhibit telomere maintenance by telomerase as a potential therapeutic strategy against cancer (7).

Except the telomere overhang, the DNA in a chromosome is double stranded and protected by proteins. However, it opens in many crucial biological processes, such as replication, transcription and promoter recognition, in which the DNA is present in single-stranded form. For quadruplex targeting, the structural specificity toward quadruplex is a key property determining the therapeutic potency and toxicity of small molecules. An ideal compound should be such that it specifically stabilizes quadruplex structure, but does not interact with DNA in the single-stranded form to avoid interfering with other biological processes. At present, several methods are available for evaluating the properties of quadruplex-stabilizing compounds. Selectivity toward quadruplex over other structures can be analyzed by the dialysis assay (8) and biosensors (9–12). Stabilization of quadruplex can be examined by the melting assay (13), the DNA polymerase stop assay (14), the PCR stop assay (15) and the telomerase repeat amplification protocol (TRAP) (16). The methods for analyzing quadruplex stabilization, except the melting assay, involve both single-stranded and quadruplex DNA. Quadruplex can also open to become unstructured during analysis. Therefore, such methods may experience cross-interference from quadruplex-irrelevant interactions. The lack of independent assessment for the effect on different structures makes them difficult to distinguish quadruplex-specific effect from quadruplex-irrelevant ones.

In the present work, we describe an exonuclease I assay for evaluating quadruplex stabilization by small molecules. The assay uses a quadruplex-forming and a non-quadruplex-forming oligomer as substrates (Figure 1). The formation of quadruplex in the former oligomer inhibits its hydrolysis and quadruplex stabilization enhances the inhibition. By comparing independent hydrolysis of the two substrates, the assay can evaluate quadruplex stabilization, discriminates inhibitory effect from different sources and helps determine the optimal compound concentration. Figure 1.

Schematic illustration of analysis of quadruplex stabilization by exonuclease I hydrolysis. (A) G-quadruplex-dependent inhibition of hydrolysis by exonuclease I. The assay uses a quadruplex-forming and non-quadruplex-forming oligomer (QFO and NQFO) labeled with ³²P at the 5′ end. The quadruplex at the 3′ end of the QFO cannot be processed by exonuclease I until it becomes unfolded. The hydrolysis does not proceed to the very end producing a short fragment of ∼8–9 nt which is separated from the input oligonucleotide by gel electrophoresis based on their size and visualized by radioautography. (B) Information provided by the exonuclease I hydrolysis assay. The assay generates hydrolysis curve for the two oligomers and clarifies inhibition from different sources: I_SS, structure-dependent inhibition by salt in the medium; I_SC, structure-dependent inhibition by compound; I_SSC, structure-dependent inhibition by salt and compound; I_NSC, non-specific inhibition by compound at high concentration via interaction with DNA or/and protein. Green bar indicates the concentration range within which the compound stabilizes quadruplex without affecting single-stranded substrate; red bar indicates the concentration range within which the compound affects hydrolysis of single-stranded substrate.

Our method used Exonuclease I to evaluate the stabilization of quadruplex by small molecules. This enzyme successively hydrolyzes nucleotides from the 3′ end of single-stranded, but not double-stranded DNA (18). Two ³²P-5′-end-labeled oligonucleotides, T₂₄(G₃T₂A)₃G₃ and T₂₄GTGTGAGTGGAGGTGTGAGGT denoted as T24G21 and T24RG21, respectively, were used as substrates. The T24G21 carried a core sequence of the G-rich strand of human telomere DNA at the 3′ end of the T₂₄ and the T24RG21 was composition and length matched to the T24G21, but with the core sequence randomized to abolish quadruplex formation. As the most extensively studied sequence, the G-rich strand of human telomere DNA forms mixed parallel–antiparallel-stranded quadruplex in K⁺ solution (21–23). The (G₃T₂A)₃G₃ moiety in T24G21 formed intramolecular quadruplex in 150 mM K⁺ solution as demonstrated by a faster migration relative to that of T24RG21 in native gel electrophoresis (Figure 2A). Figure 2B shows the K⁺ concentration dependence of quadruplex formation by (G₃T₂A)₃G₃ detected by fluorescence resonance energy transfer (FRET) analysis. The (G₃T₂A)₃G₃ was labeled at the 5′ end with FAM as a donor and the 3′ end with TMR as an acceptor. The formation of intramolecular quadruplex brought the 5′ and 3′ ends to close proximity allowing FRET between the two fluorophores to occur (17). To examine if the Exonuclease I can distinguish quadruplex structure, hydrolysis was carried out at various concentrations of K⁺. Exonuclease I is highly processive, but the hydrolysis does not proceed to the very 5′ end of a DNA leaving a short fragment of ∼8–9 residues (18). The hydrolysis product and the original input substrate remaining were easily separated by gel electrophoresis and visualized as two distinct bands on radioautograph (Figure 2C, left). In the absence of K⁺, both oligonucleotides were effectively cleaved. Additions of K⁺ resulted in resistance to hydrolysis of T24G21 in a concentration-dependent manner (Figure 2C, right) similar to that of the quadruplex formation revealed by FRET. The K⁺-induced resistance to hydrolysis is explained by quadruplex formation of the T24G21, but not by a direct effect of K⁺ because the hydrolysis of the T24RG21 that does not form quadruplex was not affected. Figure 2.

Quadruplex formation by T24G21 and its resistance to hydrolysis by exonuclease I. (A) Native gel (19%) electrophoresis showing quadruplex formation by T24G21 in 150 mM K⁺. (B) Quadruplex formation by (G₃T₂A)₃G₃ as a function of K⁺ concentration examined by fluorescence resonance energy transfer (FRET). (C) Hydrolysis of T24RG21 (open circles) and T24G21 (filled circles) by exonuclease I as a function of K⁺ concentration. (Left) Separation of input oligonucleotide and hydrolysis product (P) by gel electrophoresis. Lane 1: no exonuclease, lanes 2–9: treated with 0.04 U exonuclease I for 20 min in buffer containing increasing concentrations of K⁺. LiCl was added to make the total concentration of monovalent cation to 150 mM. (Right) Quantification of oligonucleotide hydrolysis. Data represent the mean of three experiments with standard deviation.

Several methods are currently available for analyzing quadruplex stabilization by small molecules. In the widely used DNA polymerase stop assay (14), a quadruplex-forming sequence is placed in the middle of a linear template. Quadruplex stabilization stalls DNA synthesis at the quadruplex. On the one hand, inhibition in the linear part before the quadruplex via non-specific interaction may reduce DNA synthesis reaching the quadruplex and, as a result, leading to different exposures of quadruplex to polymerase in different treatments. On the other hand, such inhibition at the linear part on both sides of the quadruplex often produce non-specific arresting bands near the one produced by the quadruplex (10,14,39–45) that may be difficult to distinguish and sequencing gel may be needed for a better resolution (14,39–41,46). The purification of DNA substrate formed by annealing the ³²P-labeled primer to the template sequence by gel electrophoresis imposed extra work for this assay (10,37,41,46). A TRAP-based method has been used for analyzing quadruplex stabilization specific to telomeric DNA (16). As is demonstrated in our Figure 6A, the inhibition on PCR may render the assay impractical for certain compounds like TMPyP4. Our data on the BMVC (Figure 4B) also indicates that the TRAP assay may not distinguish if the inhibition is on quadruplex or single-stranded substrate. In the PCR stop assay (15), quadruplex stabilization reduces primer annealing thus decreases PCR efficiency. Non-specific interactions may also have the same effect. Besides, it may also encounter similar problem as the TRAP assay since both of them involve PCR. Cationic molecules may interact with negative DNA molecules in a structure-independent manner as exemplified by the results shown in Figure 4B and D.

Our exonuclease assay provides an alternative method to evaluate quadruplex stabilization for, in principle, any quadruplex-forming sequence. Similar to the DNA polymerase stop assay, the TRAP method and the PCR stop assay, our method is applicable to intramolecular quadruplexes. It is simple, intuitive and easy to interpret. By running independent hydrolysis of two oligonucleotides, the assay avoids possible cross-interferences arising from interactions with the two forms of structures. Moreover, the assay easily clarifies contributions of inhibition from different sources (Figure 1), so one can quantify the effect of salt, quadruplex-relevant and quadruplex-irrelevant effects of small molecules separately. Such information is important in predicting the in vivo consequence of small molecules. For example, our data on TMPyP4 (Figure 3) and BMVC (Figure 4) revealed that the former was more specific and had little effect on the single-stranded DNA while the BMVC had a dramatic effect. These data suggest that, when applied in vivo, TMPyP4 may be less toxic than BMVC. In intracellular environment, quadruplex is already stabilized by ∼150 mM of K⁺. For intracellular applications, a compound will have effect only when it can further stabilize quadruplex in the presence of physiological concentration of K⁺. The different hydrolysis of the two substrates in the absence of compounds (Figure 1B) reflects the quadruplex stabilization by K⁺ in the buffer so one can easily judge, by comparing I_SC with I_SS, how a compound stabilizes quadruplex in addition to that already achieved by the K⁺. This information may be particularly useful for predicting the effect under in vivo conditions where K⁺ is present. The ratio of I_SC/I_SS can be used for calibration between assays and comparison between different compounds. The optimal concentration can also be determined at which a compound can reach maximal stabilization on quadruplex with minimal effect on single-stranded DNA.

From Figure 1B, it can be seen that the majority of quadruplex substrate has to be hydrolyzed in the absence of small molecules to allow the inhibition by small molecules to be detected. The hydrolysis in the assay is affected by the concentration of small molecules, K⁺, exonuclease I and reaction time. While the concentration of small molecules is a variable to be analyzed, the other three parameters can be adjusted to optimize the assay condition. In practice, assay conditions can be determined as follows. First of all, 150 mM of K⁺ should be preferentially used because it is the physiological concentration of K⁺ inside animal cells. Then the concentration of exonuclease I or reaction time can be adjusted to digest appropriate amount of the quadruplex-forming substrate (∼70% in our assays) in the absence of small molecules. Quadruplexes formed by certain sequences like c-myc can be very stable and resistant to exonuclease hydrolysis in 150 mM K⁺ even in the absence of small molecules. In this case, lower K⁺ concentration may be used to reduce quadruplex stability to elevate the hydrolysis of quadruplex-forming substrate to the desired degree. With fixed concentrations of exonuclease I and reaction time, one can carry out hydrolysis at various concentrations of K⁺. The proper K⁺ concentration can then be found from the K⁺ concentration-dependent hydrolysis curve. In the present work, the reaction products were analyzed by gel electrophoresis. Because there are only two bands, the analysis can be easily carried out on HPLC or capillary electrophoresis for high-throughput and large-scale screening.