The organization of our recombination plasmids was described previously (27; Fig. 1). Briefly, the two sequences to be tested for VDJ recombination are separated by a termination signal (oop). The P_tac promoter will transcribe the chloramphenicol acetyltransferase (CAT) gene when transformed in E. coli only when the termination signal was previously deleted by recombination in eukaryotic cells. All constructs used in this study were derived from Comp21 (10). Each sequence tested for recombination is flanked by unique restriction sites and forms therefore a cassette which can be easily exchanged (upstream cassette: Mlu I/Sal I, downstream cassette: SpeI/Sac II or Not I; Fig. 1). Cassettes were PCR-amplified from human genomic DNA (primers are listed in Table IV). Inverted cassettes were cloned blunt except for LMO2_i and Dδ2_i (Table IV). The J_H6 heptamer was modified to a perfect consensus by PCR site-directed mutagenesis. The 6131 cassette is a ~400 bp lacZ fragment amplified from the pCR2.1 vector (Invitrogen) after SacI/ NsiI deletion of the MCS, and allows white/blue screening. Cassettes in all constructs were confirmed by sequencing and are illustrated in Fig. 2.

18.8 Abelson murine leukemia virus transformed pre-B cells (2 × 10⁷) were transiently transfected with 20 μg of QIAGEN-purified plasmid (QIAGEN) by electroporation with a twin pulse (750 V/25 μF, 128 V/1,500 μF) using an EasyJect device (EquiBio). After 10 min on ice the cells were resuspended in 10 ml of RPMI 1640 supplemented with 10% FCS, 2 mM glutamine, and 1 mM caffeine. After 48 h, plasmids were recovered from the transfected cells by alkaline lysis, and phenol/chloroform extracted. DpnI-digested plasmids were then introduced into chemically competent TOP 10 E. coli (Invitrogen), and plated on ampicillin (50 μg/ml) and chloramphenicol (5 μg/ml). For the lacZ-containing substrates, X-Gal was added to the plates.

Clones were screened by PCR using primers located upstream and downstream of the recombination cassettes (CAACTTCTGGTCCGGTAACGTGCTG and CGATGCCATTGGGATATATCAACGGTGG; Fig. 1), followed by direct sequencing as described previously (28). PCR screens were performed from the colonies by resuspending them directly in the PCR mixture, and amplifying for 30 cycles (30 s at 94°C, 30 s at 60°C, and 1 min at 72°C). Colonies negative in the PCR screen were miniprepped and analyzed by BamHI digest. Only minipreps showing at least one BamHI cut were analyzed further. The (6131-DH3_i)/Dδ2_i construct allowed a first assessment of the recombination site based on blue/white screening. This estimation was confirmed by sequencing 10 blue colonies and all white colonies for each transfection.

Thymus samples were obtained from otherwise healthy children undergoing cardiac surgery. This study was approved by the local ethics committee. In all cases informed consent was obtained from the parents. Tissue samples were frozen on dry ice within 1 h from excision. High molecular weight DNA was prepared according to standard procedures. Quality of the DNA preparation was controlled by PCR amplification of the germline LMO2 breakpoint region (CCGTGCACCGA-AATTATTGCTGGGTAA; GTACCCACTTTGCAGGGTT-GTTGAGTGG, same conditions as calibration below) on serial dilutions of thymus DNA (100 ng, 10 ng, 1 ng, 0.1 ng). All preparations gave similar calibration curves.

The “multiple tube” method has been described previously (29). A two-step nested PCR protocol was performed on 5 μg DNA with appropriate translocus Dδ2/LMO2 (primary: TCCCTGGTCCAGTCAACTTCCTG, GAG-ATGATCAGATCCGTGCACCG, secondary: GCTGTGTT-TGTCTCCTGAGGCATGG, CCGTGCACCGAAATTATT-GCTGGGTAA), and Dδ2/Jβ2.7 (primary: TCCCTGGTCC-AGTCAACTTCCTG, GGCGGGATTCAGGTGGAAGG, secondary: GCTGTGTTTGTCTCCTGAGGCATGG, GAG-CTCGGGGAGCCTTAGAGG) primer pairs. PCR conditions used were as follows: 32 cycles (30 s at 94°C, 30 s at 64°C, and 1 min at 72°C). PCR products were cloned in TA (Invitrogen) and analyzed by sequencing. PCR conditions used for the calibration assay were identical except the number of cycles (20). Serial dilutions of the calibration plasmids (100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg) were performed in 1 μg DNA from the human lymphoma cell line RL7.

Sequence libraries of the junctions. Upstream and downstream sequences of the given recombination are indicated. For recombinants using V(D)J recombination, numbers in parenthesis indicate the status of the coding end processing (0 = precise, –n = deletion, p + n = P nucleotide). P nucleotides are shown in italics. N nucleotides are represented in bold characters. Nucleotides in parenthesis could belong to either upstream or downstream sequence or both using homology-directed recombination. For recombinants using break/repair, the location of the break is indicated. Numbers indicate the location in the core plasmid. Breaks in the cassettes are designed by the name of the cassette. If a break occurred in a cassette containing an authentic RSS (a) or a specific proto-oncogene RSS (b), the location of the break relative to this RSS is indicated (3′ or 5′). Junctions are ordered according to break location (5′ to 3′) in the upstream sequence. The online supplemental sequences are available at http://www.jem.org/cgi/content/full/195/1/85/DC1.

To functionally test several proto-oncogene sequences for their ability to target V(D)J recombination, we adapted the extra-chromosomal recombination assay (see general principle in Materials and Methods). This assay typically tests V(D)J recombination between two authentic RSSs derived from immune gene segments, which generally recombine at high frequency. In this case, most if not all recombination events obtained correspond to V(D)J recombination between these two sites. The substitution of one of the two authentic RSSs by a “fortuitous” site containing numerous mismatches from consensus (also called “cryptic” site), results in a decrease in the overall recombination frequency, and in the apparition of other low level recombination events (2). In our assay, we distinguish three distinct recombination events: (a) V(D)J recombination at the “specific” sites, i.e., between the authentic RSS and the fortuitous RSS we wish to assay (illustrated by pathway 1 in Fig. 1); (b) V(D)J recombination at “nonspecific” sites, i.e., between the authentic RSS and other fortuitous RSSs. Such fortuitous RSSs can be located either in the genomic sequence flanking the “specific” RSS (pathway 2 in Fig. 1), or in the plasmid core sequence (pathway 3 in Fig. 1); (c) Unspecific break/repair (BR) recombination events, which are defined here as not mediated by V(D)J recombination, and which constitute the background of the assay (e.g. pathway 4 in Fig. 1, no RSS involved). The potential for V(D)J targeting of the specific RSS tested is therefore assessed relatively to the other 2 “competing” recombination events. Fairly good RSSs (recombining in the range of authentic RSSs) are expected to constitute the vast majority of the readout. In contrast, increasingly poor RSSs should appear at decreasing relative rates in the total readout.

Five representative proto-oncogene breakpoint regions which have been proposed to target V(D)J recombination through fortuitous RSSs were assayed: TAL2, LMO2, TAL1, BCL1 mtc, and BCL2 mbr. For TAL2, LMO2, and TAL1, one particular fortuitous RSS has been observed in vivo in most of the breakpoints characterized so far and proposed to be responsible for V(D)J recombination targeting (Table II). The genomic regions containing the RSSs were therefore PCR-amplified and cloned in recombination substrates (Fig. 2, lines 1–3); at the BCL1 mtc and the BCL2 mbr, however, most breaks observed in vivo cluster in a region of ~400 bp (14, 30) containing several potential cryptic RSSs (Table II; references 31 and 32). In this case, the whole ~400 bp mbr and mtc regions were PCR-amplified and cloned in the recombination substrates (Fig. 2, lines 4 and 5). In the corresponding translocations observed in vivo, the proto-oncogene sequences are all fused to authentic Ig or TCR coding sequences. Furthermore, they preferentially use a specific recombination partner. Such “natural” RSS partners were therefore used as the matching recombination partners in the recombination substrates. Thus, five basic constructs were at first generated and assayed: Dβ1/TAL2, LMO2/Dδ2, TAL1/Dδ2_i, BCL1 mtc/J_H6, and BCL2 mbr/J_H6. As reference, two constructs containing consensus or near-consensus RSSs derived from immune gene segments were also assayed (VκA2.27/Jκ1, and D_H3–10/J_H6; Fig. 2, lines 6 and 7).

Results in Table V show that the control plasmids (VκA2.27/Jκ1, and D_H3–10/J_H6) gave rise to a high frequency of recombination in our assay (average 250 to 3,700 clones per transfection). As expected with authentic RSSs, most recombination events from these two constructs displayed V(D)J recombination at the specific RSSs (~98–100%). However, and as previously described, large differences in the recombination frequency were found between the two constructs, as the result of variations in the RSSs involved. Similar results were obtained for the Dβ1/TAL2 and LMO2/Dδ2 constructs: a vast majority of the recombination occurred between the specific RSSs assayed, i.e., the authentic immune RSS (Dβ1 or Dδ2) and the TAL2 or LMO2 fortuitous RSS (~96%). Nevertheless, a low level of recombination also occurred between the Dβ1 or Dδ2 RSSs and other fortuitous sites located in the core plasmid, competing therefore with TAL2 (Ψ1200, 2%) and LMO2 (Ψ200, 2%; Ψ250, 2%) (see Table III for sequences of cryptic RSSs). Altogether, these results suggest that both TAL2 and LMO2 sequences contain functional RSSs (see competition substrates analysis below). This is in agreement with recent data from Raghavan et al. (12), who also studied the LMO2 RSS in a similar recombination assay. Sequence analysis of the Dβ1/ TAL2 (n = 38) and LMO2/Dδ2 (n = 26) coding joints confirmed normal features of V(D)J recombination, including break at the coding segment/RSS border, P and N nucleotide additions and deletions (summarized in Fig. 3, A 1, for LMO2/Dδ2; full sequence libraries are shown in the online supplemental sequences). Importantly, these features are also similar to the ones observed in vivo at most derivative chromosome 7 and 14 breakpoints in t(7;9) Dβ1/TAL2 (17) and t(11;14) LMO2/Dδ2 fusion (19) (21), respectively.

For the TAL1/Dδ2_i construct, recombination rates are much lower than consensus RSSs (Table V). The majority of these events correspond to V(D)J recombination of the Dδ2 3′RSS with cryptic RSSs other than TAL1 (69%). Three different cryptic RSS located in the core plasmid were found recombined: Ψ150, 29%; Ψ6131, 34%; Ψ3490, 5%. Nevertheless, two clones (5%) showed recombination at the specific TAL1 RSS, and sequence analysis of the two coding joints confirmed normal features of V(D)J recombination, including presence of a P nucleotide (see online supplemental sequences). Additionally, cleavages occurred at the immediate border of both the TAL1 RSS (in one case at the exact border, in the other case with 1 nucleotide deletion) and the Dδ2 RSS (in one case with a P nucleotide, in the other case 2 nucleotides deletion). That the two breaks would have occurred by chance at both RSS borders in two independent clones by non-V(D)J–mediated mechanisms is very unlikely. This suggests that TAL1 fortuitous RSS can mediate V(D)J recombination, although at very low levels. Importantly, none of the competitor cryptic sites present within the genomic TAL1 ~400 bp flanking region (Fig. 2, line 3, “c” RSSs) underwent recombination. This observation is in agreement with the identification of this cryptic site as the only RSS mediating the TAL1/TCRδ translocation in this 400 bp region in vivo (22, 23).

In conclusion, these results functionally demonstrate that the fortuitous RSSs of TAL2, LMO2, and TAL1 are able to undergo V(D)J recombination. The data strongly support the view that t(7;9)(q34;q32), t(11;14)(p13;q11), and t(1;14)(p34;q11) translocations can result from bona fide V(D)J recombination between a legitimate TCR locus and an illegitimate proto-oncogene locus bearing a fortuitous but functional RSS. We will refer further to this category of translocations as “type 1.” Our results also suggest that a cryptic site with very low recombinogenic potential such as TAL1 can be involved in such type 1 translocation in vivo.

At the lower end of the recombination spectrum in Table V, the BCL2 mbr/J_H6 and BCL1 mtc/J_H6 constructs showed sublevels of recombination events, with an average of ~10 clones per transfection. Sequence analysis of these clones revealed that none of the junctions complies with the criteria of V(D)J recombination (see online supplemental sequences). In particular, breaks are not localized at the immediate border of any of the potential cryptic RSSs in the BCL2 mbr and in the BCL1 mtc, or at the border of the authentic J_H6 RSS (summarized in Fig. 3, A 2), in sharp contrast to the other constructs (e.g. LMO2/ Dδ2, Fig. 3, A 1). This is in agreement with the finding of similar break distribution in experiments performed in cells devoid of RAG activity (CHO, not shown). However, junctions generated by BR do not necessarily indicate the precise site of cleavage. To confirm our general interpretation of the breaks, and to exclude the possibility that some of the BCL2 mbr/J_H6 and BCL1 mtc/J_H6 breaks would occur at unidentified cryptic RSSs, we also tested the formation of signal joints. The presence of the signal joint in addition to the coding joint allows to diagnose unambiguously the use of the V(D)J mechanism in the recombination process. To do so, each of the two cassettes of the BCL2 mbr/J_H6 plasmid were inverted so that the retained product would correspond to a SJ instead of a CJ (Fig. 2, line 8, BCL2 mbr_i/J_H6_i). As a control, we also inverted the two cassettes of the LMO2/Dδ2 construct (Fig. 2, line 9, LMO2_i/Dδ2_i). As shown in Fig. 3 B, 100% of the LMO2_i/Dδ2_i clones (10/10) corresponded to the specific SJ, while none of the BCL2 mbr_i/J_H6_i clones (0/10) showed SJ formation. These results confirm our previous break diagnostic based on the CJ, and indicate that the recombined clones obtained for the BCL2 mbr/J_H6 and BCL1 mtc/J_H6 pairs are indeed not derived from V(D)J recombination, but from unspecific BR. Thus, none of the fortuitous 12-RSSs in the ~400 bp BCL2 mbr and BCL1 mtc were able to target V(D)J recombination with the J_H6 RSS as the “natural” recombination partner.

In the BCL2 mbr/J_H6 and BCL1 mtc/J_H6 substrates, however, the complete absence of recombination of the J_H6 RSS with other fortuitous cryptic sites in the plasmid core sequence contrasts with the situation in other constructs (Table V, other RSS: 0%). This might be due to the low recombination frequency of the J_H6 RSS due to the presence of a 22-bp spacer. Although high enough to target recombination with another authentic RSS such as D_H3.10, this frequency might be too low to generate detectable levels of recombination to cryptic sites in the core plasmid or within the BCL2 mbr and BCL1 mtc segments. To test this possibility, a new BCL1 mtc construct was designed in which the J_H6 segment was substituted by the Dδ2 segment, in signal joint configuration (Fig. 2, line 10, (BCL1 mtc_i-6131)/Dδ2_i). As an internal control for V(D)J recombination, a known cryptic site was also cloned in the plasmid. We used the “6131” cryptic site described by Lewis and colleagues, which was estimated to recombine at ~1% of the activity of a consensus RSS (2). As a reference, we constructed a similar plasmid, containing the D_H3 segment instead of BCL1 mtc (Fig. 2, line 11, (6131-D_H3_i)/Dδ2_i). As shown in Table VI, the substitution of J_H6 by Dδ2 as a recombination partner in the (BCL1 mtc_i-6131)/Dδ2_i construct still did not result in targeting V(D)J recombination at the BCL1 mtc fortuitous RSSs (0%). However, in presence of Dδ2, the vast majority of recombination events (98%) consisted of V(D)J recombination between Dδ2 and other fortuitous sites (including 6131, ~79%), leaving only 2% of BR events. The relative recombination rate between 6131 and D_H3 in the 6131-D_H3_i/Dδ2_i construct confirmed that 6131 recombines in our hands at ~1–2% of the activity of an authentic RSS. Thus, it can be estimated that the recombinogenic potential of all BCL1 mtc fortuitous sites together is <1% the rate of cryptic sites such as 6131, or <0.01% the rate of a consensus RSS.

Importantly, in the BCL2 mbr/J_H6 and BCL1 mtc/J_H6 constructs, only the appropriately oriented fortuitous 12-RSSs (5′CAC3′) were tested (Fig. 2, lines 4 and 5, white RSSs in BCL2 mbr and BCL1 mtc cassettes). However, in vivo, numerous fortuitous 23-RSS in opposite orientation (3′GTG5′) could target recombination by recombining with the authentic 12-RSSs of the D_H segments, and these potential cryptic sites also had to be tested in our assay. In the (BCL1 mtc_i-6131)/Dδ2_i construct, the Dδ2 contains two RSSs (Fig. 2, line 10): one 23-RSS in SJ configuration (black RSS) and one 12-RSS in CJ configuration (white RSS). In this construct, both potential 12- and 23- fortuitous RSSs of the BCL1 mtc in the proper orientation relative to the translocation breakpoints observed in vivo (white and black RSSs, respectively, in the BCL1 mtc cassette), were therefore assayed at once. The inability of the BCL1 mtc to target V(D)J recombination at the sensitivity estimated above takes therefore into account all potential 12- and 23 cryptic sites in the BCL1 mtc. To test in a similar way both the 12- and 23 fortuitous RSSs of the BCL2 mbr, this region (here flanked by an additional ~800 bp of surrounding genomic DNA) was also cloned with the Dδ2 partner (Fig. 2, line 12, BCL2 mbr^f/Dδ2). Similar results were found for this construct (Table VI). No recombination of the BCL2 mbr cryptic RSSs occurred (0%), while V(D)J recombination of Dδ2 to other fortuitous sites (Ψ250, 94%; Ψ150, 6%) took place in 70% of the cases. As expected, the absence of the Ψ6131 RSS resulted in a lower V(D)J recombination versus BR ratio than for the (BCL1 mtc_i-6131)/Dδ2_i construct. Thus, as the recombination rates of the cryptic sites above are lower than that of 6131, a recombinogenic potential of <0.01% the rate of a consensus RSS can also be estimated for the 12- and 23 fortuitous RSSs in the BCL2 mbr.

Altogether, these results show that fortuitous RSSs in BCL2 or BCL1 breakpoint regions are not able to target V(D)J recombination in the limit of detection of our extra-chromosomal assay (estimated as at least 1:10,000 the rate of a consensus RSS).

What is the significance of the absence of V(D)J recombination at cryptic sites in our ex vivo assay? TAL1/Dδ2_i data shows that the frequency of V(D)J recombination can be lower than the frequency of BR (Table V). Nevertheless, this low V(D)J recombination event recapitulates qualitatively the involvement of the V(D)J recombination in the TAL1/ TCRδ translocation process as observed in vivo. Thus, although indicative of the likelihood of usage of the V(D)J recombination, the relative frequency of BR versus V(D)J recombination events does not represent a physiological limit to the potential involvement of V(D)J recombination in the translocation processes. In other words, BCL1 mtc and BCL2 mbr breaks in vivo could still be the result of extremely low levels of V(D)J recombination, but with a frequency under the sensitivity of our ex vivo assay. To set the sensitivity of our assay in perspective of the in vivo process, we sought therefore to compare relative frequencies of V(D)J-mediated breaks occurring at the BCL2 locus in vivo and ex vivo. In rare cases of FL, breaks have been recently proposed to occur through V(D)J recombination at two fortuitous RSSs located outside the BCL2 break clusters (5′ of BCL2 and 3′ of mbr; reference 33). Although not leading to t(14;18) translocation per se, these cases resulted in the transposition of the BCL2 gene into the IgH locus, and in the overexpression of BCL2 in a manner similar to the t(14;18). It was estimated that this transposition event occurs in ~5% of FL cases (2/40). Thus, if one assumes that both the transposition breaks and the BCL2 mbr breaks result from a V(D)J-mediated process at fortuitous RSSs, the relative in vivo rate of V(D)J recombination at the transposition loci and at the BCL2 mbr should be ~5:95% (Table VII). To estimate the sensitivity of our ex vivo assay compared with the in vivo situation, we constructed and assayed a competition substrate containing both the 3′BCL2 region containing the fortuitous RSS involved in the transposition and the large BCL2 mbr^f segment, (Fig. 2, line 13, 3′BCL2-BCL2 mbr^f)/Dδ2). As shown in Table VII, V(D)J-mediated breaks occurred at high frequency at the 3′BCL2 RSS (100%), but not in the BCL2 mbr^f. These data first validates the suggestion of Vaandrager et al. that the transposition process they observed was indeed mediated by V(D)J recombination (33). Most importantly, these results show that the relative recombination rate of ~5% in vivo, corresponds to a relative V(D)J-recombination rate of 100% in our ex vivo assay, and therefore that BCL2 mbr breaks are not generated by V(D)J mis-targeting. No such relative frequencies can be directly assessed for BCL1 mtc in vivo. Nevertheless, considering the similar, very characteristic features of BCL1 mtc and BCL2 mbr translocation breakpoints, and the equal absence of V(D)J recombination at the detection limits of our assay, it is very unlikely that the cryptic sites in BCL1 mtc are involved in the initiation of t(11;14)(q13;q21).

This strongly supports the view that both t(14;18)(q32; q21) and t(11;14)(q13;q21) translocations belong to a category of translocation distinct from type 1, in which only the breaks at the immune locus are mediated by V(D)J recombination. Breaks at the nonimmune locus bearing the proto-oncogene are therefore initiated by other mechanisms, and could subsequently invade the V(D)J synaptic complex during the rearrangement process. Such translocation mechanism will be referred to as “type 2” in this manuscript.

To determine if the recombination rates of the functional cryptic RSSs in type 1 translocations are sufficient to compete with physiological TCR RSSs, we performed competition assays in which the proto-oncogene breakpoint region competes for recombination with the normal partner of the immune locus to which it translocates. In these competition assays, the presence of the two competing segments on the same plasmid allows a direct and very precise estimation of the relative rates of recombination (10).

This is demonstrated here by the (1:1) relative ratio obtained for a control substrate in which the two competing segments are identical (Dβ1.1/(TAL2-TAL2), Table VIII). Thus, to estimate the recombinogenic potential of the TAL2 sequence, the TAL2 segment was set to compete with Jβ2.7 for rearrangement to Dβ1.1 (Fig. 2, line 15, Dβ1.1/(TAL2-Jβ2.7)). As shown in Table VIII, the rate of recombination of TAL2 RSS is ~50 times lower than its Jβ2.7 physiological competitor (2 vs. 98%). A similar type of experiment was performed for LMO2. The Jδ1 segment was used as competitor for rearrangement to Dδ2 (Fig. 2, line 16, LMO2_i-Jδ1_i)/Dδ2_i). Strikingly, results in Table VIII indicate that the recombination frequency of the LMO2 RSS (25%) displayed only a threefold decrease relatively to the Jδ1 RSS (75%). This is slightly different from the estimation of Raghavan et al. (12) who found a 27-fold lower recombinogenic potential relative to a consensus 12-signal. However, their estimation is based on comparison with a standard consensus RSS, while we used the natural Jδ1 competitor of the t(11;14)(p13;q11) translocation which diverges from consensus at several positions (Table I).

Thus, precise quantification of the recombinogenic potentials of the TAL2 and LMO2 proto-oncogene breakpoint regions show that they are essentially in the same range as the physiologic recombination partners of the TCR Dβ and Dδ gene segments. Importantly, if the potency of a fortuitous RSS largely contributes to the final frequency of translocation in vivo, recombinogenic potentials in this range should constitute a considerable risk of genomic instability and cancer through mis-targeting by the V(D)J recombination.

The Recombinogenic Potential of the LMO2 Breakpoint Region Is Directly Predictive of the t(11;14)(p13;q11) Translocation Frequency In Vivo. To test the contribution of the re-combinogenic potential of the LMO2 proto-oncogene breakpoint region in the final frequency of the t(11;14) (p13;q11) translocation, we sought to detect the Dδ2/ LMO2 rearrangement in vivo, and to assess if the relative frequency of translocation matches the relative frequency of recombination determined ex vivo. To minimize possible bias from subsequent selection and proliferation of malignant cells carrying the specific translocation in vivo, we used thymus from healthy individuals as the source of DNA. In thymus DNA, however, the frequency of Dδ2/ LMO2 translocation cannot be assessed relatively to the Dδ/Jδ rearrangements for two main reasons: (a) Dδ/Jδ rearrangements are subject to differentiation and selection in normal thymus; (b) Dδ/Jδ rearrangements occur in cis, i.e., by deletion on the same chromosome, while Dδ2/LMO2 rearrangements occur in trans, i.e., by translocation between two chromosomes. Trans-chromosomal V(D)J recombination has been estimated to be at least 1,000 times less abundant than standard V(D)J recombination within a given receptor locus (34, 35). We reasoned therefore that since the LMO2 recombinogenic potential is comparable to those of authentic TCR RSSs, its rate of translocation with TCR gene segments should be comparable to the rates of TCR trans-chromosomal V(D)J recombination (e.g., TCRδ/β). We thus compared the relative in vivo frequencies of t(11;14)(p13;q11) (Dδ2/LMO2) and t(7;14) (q34;q11) (Dδ2/Jβ2.7) V(D)J-mediated translocations. To detect Dδ2/LMO2 and Dδ2/Jβ2.7 rearrangements, which were anticipated to be rare in thymus DNA of healthy individuals, we used a sensitive double nested PCR assay, in a “multiple tube” procedure (29). Detection of rare events by such sensitive PCR assay gives rise to fluctuation, probably depending on the presence or not of the event in the aliquot taken from the sample, and on how early in the PCR cycling the event is first amplified. To circumvent this fluctuation, each individual estimate is based on the sum of PCR products from 20–40 separate reactions, analyzed in parallel lanes. The results obtained from 3 independent thymuses are summarized in Table IX, and representative PCR signals are shown in Fig. 4. As can be seen, Dδ2/LMO2 signal joints could be detected at a strikingly high rate (55/100 [55%] reactions in 2/3 thymuses), which can be roughly estimated at ~1 translocation event every 1–10 × 10⁵ cells (34). To confirm the identity of the Dδ2/LMO2 rearrangements, the PCR bands were cloned and sequenced. All bands sequenced showed the presence of a proper Dδ2/LMO2 signal joint (see online supplemental sequences). Importantly, these breakpoints are also qualitatively similar to the two Dδ2/ LMO2 derivative chromosome 11 breakpoints described so far at that site in T-ALL (19), and to the junctions generated ex vivo in this study. In addition, comparison between Dδ2/LMO2 and Dδ2/Jβ2.7 recombination rates shows that the appearance of Dδ2/LMO2 rearrangements strikingly parallels the one of Dδ2/Jβ2.7 rearrangements (Table IX, 25/60 [42%] reactions in 2/3 thymuses). The absence of detection of both translocations in thymus 2 is not due to differences in DNA quality (see Materials and Methods) and could be related to age difference. To exclude possible bias due to differences in the efficiency of the PCR primer combinations used, each PCR amplification was calibrated. Serial dilutions of a plasmid containing either a Dδ2/ LMO2, or a Dδ2/Jβ2.7 rearrangement were PCR-amplified using the same sets of nested primers as above. Both rearrangements could be detected with a comparable sensitivity (not shown), indicating that there is no large bias in the PCR detection of the rearrangements. This suggests that the t(11;14)(p13;q11) involving Dδ2/LMO2 recombination, and the t(7;14)(q34;q11) involving TCR Dδ2/Jβ recombination, occur at similar frequencies in the thymus of healthy individuals.

Remarkably, these data show that: (a) the t(11;14)(p13;q11) involving Dδ2/LMO2 recombination previously found only in T-ALL patients, can also be detected at high frequency in thymus from healthy individuals; and (b) the recombinogenic potential of LMO2, as assessed in recombination assays ex vivo, is directly predictive of the actual in vivo rate of translocation.