C57BL/6J mice carrying the human LMNA E82K gene were established (Fig. 1). Two lines of Lmna ^E82K transgenic mice with high level of expression were selected among 53 founders by western blot analysis (Fig. 1C). The Lmna ^E82K transgenic mice were indistinguishable from their non-transgenic (NTG) littermates at birth and young-age. The death of the two transgenic lines occurred from 3 months old and mortality was 15.8% (3 of 19 for founder 30) and 11.1% (2 of 18 for founder 35) at 10 months of age respectively, while no death was observed in NTG mice.

Ventricular size and function of the two transgenic lines were assessed using echocardiography. The parameters of M-mode echocardiography from the NTG and Lmna ^E82K transgenic mice at 2, 4, 6 and 8 months of age were summarized in Table 1 and Table S1. LMNA E82K mutation significantly increased the heart to body weight ratio by 10% (Fig. 2A, n = 14, P<0.01) by gross morphology examination. The representative M-mode echocardiograms from founder 35 at 6 months of age were shown in figure 2B. To sum up, the LMNA E82K hearts exhibited thin-walled and dilated left and right ventricles when compared with NTG hearts (Table 1). Lmna ^E82K transgenic mice developed a progressive LV dilation and dysfunction associated with a progressive decrease of contractile function, evidenced by decreased LV percent fractional shortening (FS %) which exhibited a significance from 2 months of age compared with NTG mice (Table 1 and Table S1, P<0.01).

Electrocardiography (ECG) measurements were performed in mutant and NTG mice at 7 months of age (Table 2). Compared with WT mice, the PR interval and QRS complex duration had a tendency of increase in both of the transgenic lines, but only the mice generated from founder 35 showed a significant increase in the QRS complex duration (P<0.05) in 7 mice with ECG recording. Under light microscopy, myocyte disarray, interstitial fibrosis were observed in the Lmna ^E82K transgenic mice compared with the NTG mice (Fig. 2C–E). The expression level of hypertrophic markers, BNP, Actα1 and Col3α1, were obviously increased in both of the two transgenic lines compared with the NTG mice (Fig. 2F, the data from founder 35).

The immunofluorescence staining of LMNA protein indicated that LMNA E82K was mislocated in the transgenic heart instead of nuclear rim localization in the NTG heart at 7 months of age (Fig. 3A). Ultrastructural observation indicated that enlarged mitochondria and sarcoplasmic reticulum, and loss of nuclear envelope integrity due to the expression of LMNA E82K existed in the Lmna ^E82K mice compared with that of NTG mice (Fig. 3B and C).

Apoptosis of myocytes was detected in In situ terminal dUTP nick end-labeling (TUNEL) assay in heart tissue from Lmna ^E82K transgenic mice and NTG mice (Fig. 4A). The apoptotic index was increased to 5.67±2.94% in the transgenic mice while it was 0.67±1.03% in the NTG mice (Fig. 4B, n = 3, P<0.01). We found that the expression of FAS was upregulated significantly in the Lmna ^E82K transgenic mice (Fig. 5A, n = 3, P<0.05). The expression of procaspase-8 and the activated caspase-8 were increased 84.8% (Fig. 5A and B, n = 3, P<0.01) and 32.4% (Fig. 5A and B, n = 3, P<0.05) respectively. Meanwhile, the expression of procaspase-3 and the activated caspase-3 were 4.4-fold and 10.4-fold higher in the Lmna ^E82K transgenic mice than that of NTG mice (Fig. 5A and C, n = 3, P<0.001) respectively. The expression of LMNA E82K also caused the release of cytochrome c from mitochondria to cytosol, and results showed that 47% of cytochrome c in cytosolic concentrations were accompanied by decreased mitochondrial concentrations in the Lmna ^E82K transgenic mice (Fig. 6A and B, n = 3, P<0.001). Meanwhile, the expression of procaspase-9 and the activated caspase-9 were 2.9-fold and 13.5-fold higher in the Lmna ^E82K transgenic mice than that of NTG mice (Fig. 6A and C, n = 3, P<0.001) respectively. The results suggested that LMNA E82K mutation induced apoptosis in the heart is likely mediated by both of the FAS and mitochondrial pathways.

The G→A substitution of LMNA cDNA (IMAGE: 2822703) that results in the E82K mutation in the protein was induced using the QuikChange site-directed mutagenesis kit (Stratagene, USA) and the sequence was confirmed by DNA sequencing. The mutated cDNA was cloned into an expression plasmid under the α-MHC promoter. The transgenic mice were generated by microinjection method [44]. Genotyping of transgenic mice was facilitated by the polymerase chain reaction (PCR) using the primers, 5′ AGAAGGAGGGTGACCTGATAG and 5′ ACCAGGTTGCTGTTCCTCT. The desired 490 bp fragment of the transgenic gene was amplified for 35 cycles at condition of 94°C for 30 s, 57°C for 30 s and 72°C for 30 s. The expression of the target gene was analyzed by western blot analysis using antibody to human LMNA (Santa Cruz). All the mice were bred in an AAALAC-accredited facility and the use of animals was approved by the Animal Care and Use Committees of The Institute of Laboratory Animal Science of Peking Union Medical College (GC08-2001).

For light microscopy, cardiac tissue from mice at 6 months of age was fixed in formaldehyde and mounted in paraffin blocks. Sections were stained with Hematoxylin and Eosin (H&E) or Masson trichrome. For electron microscopy, cardiac tissue was routinely fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) and postfixed in 1% osmium tetroxide buffer for 1 hr. The sections were stained with uranyl acetate and lead citrate and examined under a JEM-1230 transmission electron microscope.

Mice were lightly anesthetized by intraperitoneal injection of tribromoethanol at a dose of 18 ml/kg body weight. M-mode echocardiography was performed at 2, 4, 6 and 8 months of age for each transgenic mouse with a 30 MHz transducer (Vevo770, Canada) [44], [45].

Mice were fixed in the supine position on a heating pad to maintain core body temperature, and limb leads were place subcutaneously in accordance to chosen preferential derivation (lead II). Traces were recorded using a digital system (ADInstruments, USA) connected to a bioamplifier. The traces were analyzed using the LabChart software package (ADInstruments, USA) by an investigator who was blinded to the genotypes of the mice.

Total RNA was isolated from mice heart tissues using TRIzol Reagent (Invitrogen). First-strand cDNA was synthesized according to the Superscript III reverse transcriptase manufacturer' protocol (Invitrogen). The expression level of mRNA for ANP, BNP and Col3α1 was carried out by the RT-PCR and GAPDH was used as normalization (For ANP, 5′- ATGGGCTCCTTCTCCATCAC and 5′- TTATCTTCGGTACCGGAAGCTG; For BNP, 5′- ATGGATCTCCTGAAGGTGCTGTC and 5′- CTACAACAACTTCAGTGCGTTAC; for Col3α1, 5′- GGCAGTGATGGGCAACCT and 5′- TCCCTTCGCACCGTTCTT; for GAPDH, 5′- CAAGGTCATCCATGACAACTTTG and 5′- GTCCACCACCCTGTTGCTGTAG).

Total protein lysates from mice heart tissues were prepared by homogenizing with lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, and protease inhibitor cocktail). After performing SDS-PAGE and transfer to nitrocellulose (Immobilon NC; Millipore), the membranes were incubated overnight with antibody to Lamin A/C (Santa Cruz); Actα1 (Abcam); FAS (Santa Cruz); caspase-3 (Cell Signaling); caspase-8 (Cell Signaling) or caspase-9 (Cell Signaling). After incubation with the appropriate secondary antibody for 1 h at room temperature, antibody binding was detected with a HRP-conjugated immunoglobulin G (Santa Cruz) using a chemiluminescent detection system (Westernblotting luminal reagent, Santa Cruz). GAPDH was served as normalization.

The sections of hearts were prepared in a standard pathological procedure. The sections were dewaxed, rehydrated, unmask the epitope, blocked, then incubated with anti-lamin A/C monoclonal Ab (Santa Cruz) overnight at 4°C Sections were washed with PBS and incubated with DyLight-conjugated, affinity-purified anti-mouse IgG (KPL) for 1 hr at room temperature, and all slides were counterstained with 300 nM 4,6-diamidino-2-phenylindole (DAPI, Invitrogen). After washing with PBS, sections were mounted in ProLong Gold antifade reagent (Invitrogen). Images of the sections were collected and analyzed under confocal laser scanning microscopy (Leica TCS SP2, Germany).

TUNEL assay was performed in sections using an In Site Cell Death Detection Kit (Roche Diagnostics GmbH, Mannheim, Germany) principally according to the manufacturer's instructions. The sections of heart tissues were incubated with the TUNEL reaction mixture for 1 hr at 37°C in a dark, humidified chamber. Labeled DNA was visualized with an anti-fluorescein antibody conjugated with peroxidase (POD) using 3,3′-diaminobenzidine (DAB) as the chromogen. Sections were then washed, counterstained with hematoxylin. For negative control, TdT was omitted from the reaction mixture. Six images per heart (3 hearts per genotype group) were acquired, and positive cells were counted individually. Results were expressed as the percentage of apoptotic cells among the total cell population.

A whole mouse heart from mice were excised and washed in cold PBS and the cytosolic and mitochondria fractions were derived following the Mitochondrial/Cytosol Fractionation Kit manufacturer's protocol (DBI Bioscience). The cytochrome c content in cytosol and mitochondria was detected by western blot analysis using antibody to cytochrome c (Cell Signaling). GAPDH was served as normalization.

Data was analyzed with unpaired two-tailed Student's t-tests for two groups, or one-way ANOVA for multiple groups followed by a Tukey's post hoc analysis. Data were expressed as mean ± SEM from individual experiments. Differences were considered as significant at P<0.05.