The following procedures have been either described in detail or cited previously:^10,16 generation of DNA template by polymerase chain reaction (PCR) using “split-primer”; synthesis of mRNA and protein in parallel; estimation of the amounts of synthesized proteins by densitometric scanning of the Coomassie brilliant blue (CBB)-stained bands or by autoradiography. The wheat germ extract was purchased from Cell-Free Science Co. (Yokohama, Japan). Anti-p53 monoclonal antibody (D01) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse serum for mouse immunoglobulin in Figure 1 was purchased from Calbiochem (Darmstadt, Germany). Other reagents used in this study were described previously.^10,15

MRL/lpr mice were originally purchased from the Jackson Laboratory (Bar Harbor, ME). All of the mice used in this paper were maintained in clean rooms at the Animal Research Institute, School of Medicine, Ehime University. Sera of female mice were collected from 15 mice and pooled and stocked in −20 °C until use. All experiments were done according to the Guidelines for the Care and Use of Laboratory Animals at Ehime University.

Functional annotation of mouse (FANTOM) as a mouse full-length cDNA resource is purchased from a company (Danaform, Tokyo, Japan). The DNA templates for transcription were constructed by “split-primer” PCR technique described previous reports.^10,17 The first PCR was amplified with 10 nM of each of the following primers: a gene specific primer, 5′- CCACCCACCACCACCAATGnnnnnnnnnnnnnnnnnnn (n denotes the coding region of the target gene), and AODA2303 (5′-GTCAGACCCCGTAGAAAAGA) or AODS (5′-TTTCTACGGGGTCTGACGCT). The second PCR products for protein synthesis were constructed with 100 nM SPu 5′-GCGTAGCATTTAGGTGACACT, 1 nM deSP6E02bls-S1 (5′-GGTGACACTATAGAACTCACCTATCTCTCTACACAAAACATTTCCCTACATACAACTTTCAACTTCCTATTATGGGCCTGAACGACATCTTCGAGGCCCAGAAGATCGAGTGGCACGAACTCCACCCACCACCACCAATG) and 100 nM AODA2303 or AODS. By this “split-primer” PCR, the bls was fused onto the N-terminals of all the genes for protein biotinylation.(13)

Cell-free construction of the BPL is based on the previously described bilayer diffusion system in which 1 μL (50 ng) crude cell-free expressed BirA was added to the translation layer and 500 nM d-biotin (Nacalai Tesque, Kyoto, Japan) was added to both the translation and substrate layers.^13,18In vitro transcription and cell-free protein synthesis for the BPL were carried out using the GenDecoder1000 robotic synthesizer (CellFree Sciences Co.) as previously described.^17,19

The AlphaScreen assay was performed according to the manufacture’s protocol (PerkinElmer Life and Analytical Sciences, Boston, MA). Reactions were carried out in 25 μL of reaction volume in 384-well Optiwell microtiter plates (PerkinElmer Life and Analytical Sciences). For the antigen−autoantibody reaction, the translation mixture expressing the biotinylated protein was mixed with MRL/lpr mouse serum diluted 1:600 in 15 μL of reaction buffer [100 mM Tris-HCl (pH 8.0), 0.01% (v/v) Tween-20 and 0.1% (w/v) bovine serum albumin] and incubated at 26 °C for 30 min. Subsequently, 10 μL of streptavidin-coated donor beads and protein A-conjugated acceptor beads (PerkinElmer Life and Analytical Sciences) were added to a final concentration of 20 μg/mL per well and incubated at 26 °C for 1 h in a dark box. Fluorescence emission was measured with the EnVision plate reader (PerkinElmer Life and Analytical Sciences), and the resultant data were analyzed using the AlphaScreen detection program. All repetitive mechanical procedures were performed by a Biomek FX robotic workstation (Beckman Coulter, Fullerton, CA).

Biotinylated proteins were partially purified using streptavidin-coated beads (Streptavidin Sepharose High Performance, GE Healthcare, Buckinghamshire, U.K.). Translation mixtures (150 μL) including biotinylated proteins were mixed with 10 μL of streptavidin-coated beads for 30 min. The resin was washed three times with PBS buffer and then boiled in 15 μL of SDS sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol and 0.2% bromophenol blue). After separation by 12.5% SDS-PAGE, the proteins were transferred to PVDF membrane (Millipore, Bedford, MA) by semidry blotting. The membrane was soaked in PBS containing 5% (w/v) skim milk for 1 h and then incubated with serum diluted 1:200 in PBS containing 0.1% (v/v) Tween 20 (PBST) for 1 h. After washing three times in PBST, it was incubated in PBS including goat-antimouse IgG-HRP antibody (GE Healthcare) diluted 1:10 000 for 30 min. After washing three times in PBST, the blots were detected by the ECL plus detection system (GE Healthcare) by using Typhoon 9400 imaging system (GE Healthcare) according to the manufacturer’s protocol.

Fifty microliters of translation mixture expressing biotinylated proteins were incubated in 50 μL of IP buffer [PBS containing 0.1% (w/v) BSA, 0.15% (v/v) Tween 20] with 1 μL of undiluted serum overnight at 4 °C. Immobilized Protein A sepharose (20 μL of 50% slurry, Protein A Sepharose 4 Fast Flow, GE Healthcare) in IP buffer was added to each sample and incubated for 60 min at 4 °C. After centrifugation for 1 min at 900× g, samples were washed three times with IP buffer and then boiled for 5 min in SDS sample buffer. After separation by 12.5% SDS-PAGE, the samples were transferred to a Hybond-LFP PVDF membrane (GE Healthcare). After blocking with 5% (w/v) skim milk in PBS overnight at 4 °C, the membranes were soaked in PBS buffer containing 10 μg/mL streptavidin Alexa Fluor 488 conjugate (Alexa488-STA) (Invitrogen, Carlsbad, CA) and were washed three times with PBST. The biotinylated proteins on membrane were detected by Typhoon 9400 imaging system (GE Healthcare) according to the manufacturer’s protocol.

We adapted that AlphaScreen technology toward detecting interactions between antigen protein and antibody. To validate this technique, we used p53 protein, a well-characterized antigen protein.(20) Biotinylated or nonbiotinylated recombinant p53 and biotinylated recombinant dihydrofolate reductase (DHFR), serving as negative control, were synthesized by the wheat cell-free system (Figure 1A). For the analysis of antigen protein−antibody interaction, the translation mixture was used without any purification. In the AlphaScreen system, interaction of the biotinylated protein and antibody in sera results in a biotinylated protein−antibody complex that is captured simultaneously by the streptavidin-coated donor beads and the protein A-conjugated acceptor bead. The resultant proximity of the acceptor and donor bead generates the luminescent signal upon irradiation at 680 nm. This is illustrated in Figure 1B.

For biotinylation of the target protein, the N-terminus of the target was fused to the bls, and the cell-free system was supplemented with BirA and biotin.(13) This biotin ligation method yields a biotin labeling on the bls, indicating a specific recognition of the target protein by AlphaScreen. To investigate the specificity and sensitivity of the antibody detection, translation mixtures expressing biotinylated or nonbiotinylated p53 protein were incubated with various concentrations of monoclonal antibody, ranging from 5 × 10⁻³ to 5 × 10² pg/μL. This luminescence method specifically detected interaction of monoclonal antibody and the biotinylated p53 from the unpurified translation mixture, whereas nonbiotinylated p53 and biotinylated DHFR did not produce a significant luminescent signal (Figure 1C). In this condition, the biotinylated p53 was detected by anti-p53 antibody at concentrations as low as 0.5 pg/μL. Next, we investigated whether this luminescence method could detect the biotinylated protein−antibody complex in the presence of mouse serum. Translation mixture expressing biotinylated p53 protein was incubated with various concentrations of monoclonal antibody from 2 to 200 pg/μL and mouse immunoglobulin from 0.4 to 40 ng/μL. Figure 1D showed that this method could specifically detect the immunocomplex of biotinylated p53 protein and monoclonal antibody in the presence of an excess of mouse immunoglobulin. In addition, comparison between the specific luminescence and background signals indicated that biotinylated p53 could be detected at more than 0.05% of anti-p53 antibody in mouse serum (Figure 1E). These results indicate that this system is a highly specific and sensitive method for detection of interaction between biotinylated recombinant protein and antibody in whole serum.

We next tested our protocol for the well-characterized autoantigens histidyl-tRNA synthetase (Hars)(21) and lamin B2 (LmnB2)(22) in the autoimmune disease model mouse MRL/lpr.(23) To determine the assay conditions using serum samples, biotinylated recombinant Hars and LmnB2 proteins were used (Figure 2A) to detect autoantibody in the sera of MRL/lpr mice. Cell-free synthesis of biotinylated Hars and LmnB2 demonstrated yields of 820 and 600 nM, and 43.0 and 56.4% of biotinylation, indicating biotinylated Hars and LmnB2 proteins were 354.4 and 338.5 nM, respectively. Various volumes (0.003 to 4 μL) of translation mixture expressing biotinylated Hars or LmnB2 protein were incubated with the serum of MRL/lpr mouse (final 1:1000 dilution) in 25 μL of reaction volume (Figure 2B). Significant luminescent signals were observed at additions of biotinylated Hars or LmnB2 proteins between 0.01 and 1 μL, which corresponds to biotinylated protein concentrations between 0.14 and 14 nM or 0.13 and 13 nM, respectively. Also serum dilutions between 1:500 and 1:10 000 produced high luminescence signal in 25 μL of reaction volume using 1 μL of the translation mixtures (Figure 2C). These results mean that five micro litter of serum and 200 μL of cell-free translation mixture expressing biotinylated proteins would be sufficient for 200 assays. Taken together, these results suggest that the luminescence method using cell-free expressed biotinylated proteins would be useful for screening the reaction of autoantigen proteins with autoantibodies in serum.

It has long been thought that comprehensive screening using a protein library is a strong tool for identification of antigen proteins.^12,24,25 The scheme for the BPL-based screening is shown in Figure 3A. To construct the N-terminal BPL, we selected 226 genes (Supplementary Table 1, Supporting Information) that included well-known autoantigen proteins and proteins coded by genes in the mouse autoimmune susceptibility loci(26) from the mouse full-length cDNA resource (FANTOM).^27,28 For biotinylation, a bls was fused onto 5′ site of a target gene by “split-primer” PCR.(13) Using the PCR, 222 (98.2%) out of 226 genes were successfully amplified and of those, 217 (96%) were transcribed. Synthesis of biotinylated proteins was performed on the GenDecoder1000,(19) and expression confirmed by SDS-PAGE combined with immunoblot analysis using Alexa488-STA (Figure 3B). Finally 214 clones (94.6%) were produced as biotinylated proteins (Supplementary Table 1, Supporting Information) at maximum and minimum concentrations of 500 and 10 nM respectively (data not shown). From our results in Figure 2B, the immunoresponse of biotinylated proteins could be detected below 0.2 nM by the luminescence method, indicating that all 214 proteins are at concentrations viable for screening. Therefore, we used these proteins as the BPL for screening of autoantigen proteins.

To identify autoantigen proteins reacting with antibodies in serum of autoimmune disease mice, the BPL and sera from pools of MRL/lpr or normal mouse sera (NMS) were used. In each well of a 384-well plate, a translation mixture expressing biotinylated protein was incubated with either serum for 30 min, and subsequently a mixture of donor and acceptor beads was added to each well (see Figure 1B). After incubation, antigen−antibody reaction of the BPL was detected by the luminescence assay as described above. As shown in the scatter plot (Figure 3C), the intensity of paired luminescent signals in each well of two independent screening data sets (plate 1 and 2) using MRL/lpr mouse sera showed a linear distribution with a R² of 0.963, indicating reproducibly sufficient score for screening. We then compared the luminescent signals of the BPL reacted with MRL/lpr sera and NMS (Figure 3D). In this assay, only 141 of the 214 proteins in the BPL were identified as positive clones, which was indicated by a luminescence signal 5-fold higher than the average background signal. Only 96 proteins in the 141 positive clones reacted with MRL/lpr sera, whereas the remaining 45 proteins interacted with both sera. From these results, 96 proteins were identified as autoantigen proteins in MRL/lpr mice (Table 1, upper left panel in Figure 3D). In these MRL/lpr autoantigen proteins, 25 well-known autoantigens were included, and 71 out of 96 clones were coded in the genetic loci on chromosome 10; 40 cM, chromosome 15; 18 cM and chromosome 19; 49 cM,(26) indicating that this screening identified new MRL/lpr sera reactive autoantigen proteins. Interestingly, these loci were reported as the susceptibility loci of arthritis. Furthermore, according to Gene Ontology (GO) Database (http://www.geneontology.org/), 73 (76%) of the proteins were classified by cellular localization (Figure 3E) and 25 (26%) classified by biological function/process (Figure 3F). The annotated proteins found were classified as localized with Membrane (22%), Membrane/Cytoplasm (4%), Extracellular space (7%), Nucleus (13%), Nucleus/Cytoplasm (13%), Cytoplasm (7%) and Mitochondrion (2%). Also, the annotated proteins were involved in diverse biological functions/processes such as Kinase activity (8%), Kinase activity/peptidase activity (1%), transcription (8%), Transcription/Translation (1%), Translation (3%), Ubiquitin/Translation (1%) and Peptidase activity (3%). Data analysis showed that 26 and 25 proteins were annotated in localization of nucleus and cytoplasm respectively (Figure 3E, Table 1), and that 9 and 9 proteins were related to cellular events of protein phosphorylation and transcription, respectively (Figure 3F, Table 1). Many nuclear proteins were reported as autoantigens.(2) Interestingly, localization of 38 (39.6%) antigen proteins reacting with antibodies in MRL/lpr mouse sera was annotated in membrane and/or extracellular space. These results suggest that the wheat cell-free system is a viable platform to study folded membrane proteins that function as antigens. The data analysis suggests that MRL/lpr autoantigen proteins are represented by a wide variety of biological functions localized in whole cells, rather than just nuclear proteins. Taken together, these results indicate that the BPL-based screening method would be useful for identification of autoantigen proteins.

Recent reports have mentioned the possibility that autoantibodies may react with conformational epitopes.²⁹⁻³¹ These data were obtained by liquid phase immunoprecipitation assays using recombinant proteins.^32,33 Under these situations, autoantigen proteins we found were analyzed by immunoblotting and immunoprecipitation. For this analysis, six proteins were randomly selected (see legend in Figure 4). Immunoblot analysis showed that three proteins reacted with MRL/lpr mouse sera (Lanes 2, 5, and 6 in Figure 4A). Two of these three proteins, LmnB2 (Lane 5) and topoisomerase II alpha (Top2a) (Lane 6), have been well characterized as autoantigen proteins so far.^22,34 Also, six of our identified autoantigen proteins were not detected by immunoblot analysis in the sera of NMS (data not shown). Interestingly, immunoprecipitation analysis revealed antigenicity of all six autoantigen proteins (Figure 4B, C), whereas two proteins randomly selected from nonautoantigen proteins, serving as a negative control, did not show significant reaction to the sera from MRL/lpr mice by both immunoblot analysis and immunoprecipitation (Lanes 7 and 8 in Figure 4A, B). These results suggest that the BPL-based screening method may be useful for identification of autoantigen proteins reacting with autoantibodies recognizing conformational epitopes.

Alexa488-STA, streptavidin Alexa Fluor 488 conjugate; NMS, normal mouse sera; SEREX, serological expression cloning; SERPA, serological proteome analysis; bls, biotin ligation site; DHFR, dihydrofolate reductase; Lmnb2, lamin B2; Hars, histidyl-tRNA synthetase; Top2a, topoisomerase II alpha; Hhex, hematopoietically expressed homeobox; Tdg, thymine DNA glycosylase; Sgta, small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha; Slc1a6, solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6; Cs, citrate synthase; Car4, carbonic anhydrase 4; BPL, biotinylated protein library; FANTOM, functional annotation of mouse; CBB, coomassie brilliant blue; RF, rheumatoid factor; hnRNP, heterogeneous nuclear ribonucleoprotein; Sm, Smith; GO, Gene Ontology; NHS, N-hydroxysuccinimide; RA, rheumatoid arthritis; SLE, systemic lupus erythematosus; MRL/lpr, MRL/Mp-lpr/lpr.