Nano-anatase TiO₂ was prepared via controlled hydrolysis of titanium tetrabutoxide. The details of the synthesis are as follows [16]: Colloidal titanium dioxide was prepared via controlled hydrolysis of titanium tetrabutoxide. In a typical experiment, 1 mL of Ti(OC₄H₉)₄ dissolved in 20 mL of anhydrous isopropanol was added dropwise to 50 mL of double distilled water adjusted to pH 1.5 with nitric acid under vigorous stirring at room temperature. Then, the temperature was raised to 60 °C and kept 6 h for better crystallization of nano-TiO₂ particles. The resulting translucent colloidal suspension was evaporated using a rotary evaporator yielding a nanocrystalline powder. The obtained powder was washed three times with isopropanol and dried at 50 °C until complete evaporation of the solvent. The average grain size calculated from broadening of the (101) X-ray diffraction peak of anatase (Fig. 1) using Scherrer’s equation was approximately 5 nm. The Ti²⁺ content in the nano-anatase was measured by inductively coupled plasma mass spectroscopy (ICP-MS), and O, C, and H contents in the nano-anatase were assayed by Elementar Analysensysteme Gmbh, showing that Ti, O, C, and H contents in the nano-anatase were 58.114, 40.683, 0.232, and 0.136%, respectively. Bulk TiO₂ (rutile) was purchased from Shanghai Chem., Co., and the average grain size was 10–15 μm.

A 0.5% hydroxypropylmethylcellulose K4M (HPMC, K4M) was used as a suspending agent. Nano-anatase TiO₂and bulk TiO₂powder was dispersed onto the surface of 0.5%, w/v HPMC, and then the suspending solutions containing nano-TiO₂and bulk TiO₂particles were treated by ultrasonic for 30 min and mechanically vibrated for 5 min.

CD-1 (ICR) mice of 70 females (20 ± 2 g) were purchased from the Animal Center of Soochow University. Animals were housed in stainless steel cages in a ventilated animal room. Room temperature was maintained at 20 ± 2 °C, with relative humidity at 60 ± 10%, and a 12-h light/dark cycle. Distilled water and sterilized food for mice were available ad libitum. They were acclimated to this environment for 5 days prior to dosing. All procedures used in animal experiments were in compliance with the local ethics committee. Animals were randomly divided into seven groups: control group (treated with 0.5% HPMC) and six experimental groups. Experimental groups were injected into abdominal cavity with nano-anatase TiO₂(5, 10, 50, 100, and 150 mg/kg BW) and with bulk TiO₂(150 mg/kg BW) everyday for 14 days, respectively. The control group was treated with 0.5% HPMC. The symptom and mortality were observed and recorded carefully everyday for 14 days. After 14 days, the body weight of all animals were weighed accurately and sacrificed after being anesthetized by ether. Blood samples were collected from the eye vein by removing the eyeball quickly. Serum was collected by centrifuging blood at 2,500 rpm for 10 min. The tissues and organs, such as liver, spleen, kidneys, lung, heart, and brain, were excised and washed carefully using 95% saline, then weighed accurately.

After weighing the body and tissues, the coefficients of liver to body weight were calculated as the ratio of tissues (wet weight, mg) to body weight (g).

The DNA was extracted from the liver and purified as described by the manual of DNA kits (Takara company), A260/A280 (>1.8) indicated that the DNA was sufficiently free of protein. The purified DNA was resuspended in Tris–HCl buffer (pH 7.2).

Tissues were taken out and thawed. About 0.1–0.3 g of each liver tissue and 0.5 mg of liver DNA from various treated mice were weighed, digested, and analyzed for titanium content. Briefly, prior to elemental analysis, the tissues of interest were digested in nitric acid (ultrapure grade) overnight. After adding 0.5 mL of H₂O₂, the mixed solutions were heated at about 160 °C using high-pressure reaction container in an oven chamber until the samples were completely digested. Then, the solutions were heated at 120 °C to remove the remaining nitric acid until the solutions were colorless and clear. At last, the remaining solutions were diluted to 3 mL with 2% nitric acid. ICP-MS (Thermo Elemental X7, Thermo Electron Co.) was used to analyze the titanium concentration in the samples. Of indium, 20 ng/mL was chosen as an internal standard element. The detection limit of titanium was 0.076 ng/mL. Data are expressed as nanograms per gram of fresh tissue.

Liver function was evaluated with serum levels of alanine aminotransferase (ALT), alkaline phosphatase (ALP), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), pseudocholinesterase (PChE), leucine acid peptide (LAP), total protein, albumin (ALB), globulin (GLB), and total bilirubin (TBIL), triglycerides (TG), total cholesterol (TCHO), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) using the commercial kits (Bühlmann Laboratories, Switzerland). All biochemical assays were performed using a clinical automatic chemistry analyzer (Type 7170A, Hitachi, Japan).

For pathological studies, all histopathological tests were performed using standard laboratory procedures. The tissues were embedded in paraffin blocks, then sliced into 5 μm in thickness and placed onto glass slides. After hematoxylin–eosin (HE) staining, the slides were observed, and the photos were taken using optical microscope (Nikon U-III Multi-point Sensor System, USA), and the identity and analysis of the pathology slides were blind to the pathologist.

Liver was fixed by 2.5% glutaraldehyde in 0.1 mol/dm³cacodylate buffer for 2 h, washed three times with 0.1 mol dm cacodylate buffer (pH 7.2–7.4) and post-fixed for 1 h in 1% osmium tetroxide. The specimens were dehydrated by a graded series of ethanol (75, 85, 95, and 100%) and embedded in Epon 812. Ultrathin sections were obtained, contrasted with uranyl acetate and lead citrate and observed with a JEOL 1010 transmission electron microscope.

The mRNA expression of nucleic factor-κB (NF-κB), macrophage migration inhibitory factor (MIF), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1β (IL-1β), cross-reaction protein (CRP), interleukin-4 (IL-4), and interleukin-10 (IL-10) were determined by real-time quantitative RT polymerase chain reaction (RT-PCR) [17-19]. Liver in the same growth period from the three different treatments were used. The right livers from mice with or without nano-anatase TiO₂ treatment were homogenized using QIAzol lysis reagent with a Tissue Ruptor (Roche). Total RNA from the homogenates was isolated using Tripure Isolation Reagent (Roche) according to the manufacturer’s instructions. The RT reagent (Shinegene, China) of 30 μL was prepared by mixing 15 μL of 2× RT buffer, 1 μL random primer in a concentration of 100 pmol μL⁻¹, 1 μL of RTase, 5 μL RNA, and 8 μL DEPC water together. The reaction condition was 25 °C for 10 min, 40 °C for 60 min, and 70 °C for 10 min.

Synthesized cDNA was used for the real-time PCR. Primers were designed using Primer Express Software according to the software guidelines.

The primer sequence is: Mnfkb1f: CATCCAACCTGAAAATCGTGAG, Mnfkb1r: CCCCAAATCCTTCCCAAACT, 156 bp; mil1bf: AAGTTGACGGACCCCAAAAG, mil1br: TGAGTGATACTGCCTGCCTGA, 129 bp; mtnff: TACTGAACTTCGGGGTGATCG, mtnfr: CCACTTGGTGGTTTGCTACG, 156 bp; mil4f:TGTAGGGCTTCCAAGGTGCT, mil4r: TGATGCTCTTTAGGCTTTCCAG, 199 bp; mil6f: GTTGCCTTCTTGGGACTGATG, mil6r: ACTCTTTTCTCATTTCCACGATTT, 172 bp; mil10f: TGGACAACATACTGCTAACCGAC, mil10r: CCTGGGGCATCACTTCTACC, 111 bp; mcrpf: GCGGAAAAGTCTGCACAAGG, mcrpr:GGAGATAGCACAAAGTCCCACAT, 153 bp; mmiff: CCATGCCTATGTTCATCGTGA, mmifr: ATCGTTCGTGCCGCTAAAAG, 167 bp; m actin f:GAGACCTTCAACACCCCAGC, m actin r: ATGTCACGCACGATTTCCC, 263 bp.

All primers were purchased from Shinegene. For the 50 μL PCR reaction, 25 μL 2× PCR buffer, 0.6 μL 2× primers (25 pmol μL⁻¹), 0.3 μL probe (25 pmol μL⁻¹), 1 μL cDNA, and 22.8 μL DEPC water (Sigma) were mixed together. The parameters for a two-step PCR were 94 °C for 3 min, 94 °C for 20 s, 60 °C for 20 s, then 72 °C for 20 s, 35 cycles.

The gene expression analysis and experimental system evaluation were performed according to the standard curve and quantitation reports.

To determine NF-κB, MIF, TNF-α, IL-6, IL-1β, CRP, IL-4, and IL-10 levels of the plasma, enzyme linked immunosorbent assay (ELISA) was performed by using commercial kits that are selective for mouse NF-κB, MIF, TNF-α, IL-6, IL-1β, CRP, ILIL-4, and IL-10 (Biological Marker Laboratory, Inc., USA). Manufacturer’s instruction was followed. The absorbance was measured on a microplate reader at 450 nm (Varioskan Flash, Thermo Electron, Finland) and the NF-κB, MIF, TNF-α, IL-6, IL-1β, CRP, IL-4, and IL-10 concentration of samples were calculated from a standard curve.

Statistical analyses were done using SPSS11.5 software. Data were expressed as means ± SD. One-way analysis of variance (ANOVA) was carried out to compare the differences of means among multi-group data. Dunnett’s test was carried out when each group of experimental data was compared with solvent-control data. Statistical significance for all tests was judged at a probability level of 0.05.

After 14 days, the mice were weighed, various organs were collected and they were also weighed. Table 1shows the coefficients of the liver to body weight which were expressed as milligrams (wet weight of tissues)/grams (body weight). No obvious differences were found in the body weight of seven groups. The significant differences were not observed in the coefficient of the liver in the 5 and 10 mg/kg BW nano-anatase TiO₂-treated groups (p > 0.05). However, the coefficients of the liver in the 50, 100, and 150 mg/kg BW nano-anatase TiO₂-treated groups and 150 mg/kg BW bulk TiO₂-treated group were significantly higher (p < 0.05 or 0.01) than the control, suggesting that higher dose nano-anatase TiO₂and bulk TiO₂might cause the damage of the liver of mice.

The contents of titanium in liver and the purified DNA from liver of mice during 14 days daily injection of various doses nano-anatase TiO₂and 150 mg/kg BW bulk TiO₂are shown in Fig. 2. With increasing injection dose of nano-anatase TiO₂, the titanium contents in the liver and DNA were significantly elevated, this observation suggested that the accumulation of titanium in the liver and DNA was closely related to the coefficients of the liver of mice, suggesting that, after entering the animals, nano-TiO₂combine with the biomolecules such as DNA. However, the contents of titanium of the liver and DNA in 150 mg/kg BW bulk TiO₂-treated group were lower than those of 150 mg/kg BW nano-anatase TiO₂-treated group (p < 0.05), suggesting that nano-anatase TiO₂entered the liver of mice and combined with the DNA more easily than the bulk TiO₂did.

The serum biochemical parameters were assayed to further evaluate the toxicity of nano-anatase TiO₂on the liver of mice. Table 2exhibits the changes of biochemical parameters in serum of mice liver after nano-anatase TiO₂suspension was injected into abdominal cavity for consecutive 14 days. In lower doses (5 and 10 mg/kg BW), there were no significant changes for all the parameters compared with the control group (p > 0.05). In higher dose of nano-anatase TiO₂-treated (50, 100, and 150 mg/kg BW) groups, however, the activities of ALT, ALP, AST, LDH, PChE, and LAP were significantly higher than the control group (p < 0.05 or 0.01), and the obvious enhancement of ALB, GLB levels, the reduction of ratio of ALB to GLB, TBIL levels were observed in comparison with the control group (p < 0.05). In the 150 mg/kg BW bulk TiO₂-treated group, there were only ALT, ALP, AST, LDH, PChE, and LAP higher than those of control (p < 0.05 or 0.01), and the other parameters had no obvious difference from the control group (p > 0.05). The increase of ALT, ALP, AST, LDH, PChE, and LAP, and the decrease of ratio of ALB to GLB, TBIL levels which are important indicators of the hepatic injury, demonstrated that nano-anatase TiO₂induced hepatic injury. Furthermore, the increase of enzyme activity and the decrease of ratio of ALB to GLB, TBIL levels are dose-dependent, inferring that the induced hepatic injury is dose-dependent. TG, TCHO, and HDL-C from 100 to 150 mg/kg BW-treated groups were higher than the control group (p < 0.05). LDL-C contents from 100 to 150 mg/kg BW nano-anatase TiO₂treated groups were lower than the control group (p < 0.05). In the 150 mg/kg BW bulk-TiO₂-treated group, the contents of THCO and HDL-C were higher than the control group (p < 0.05), but the contents of TG and LDL-C were not significantly different from the control group (p > 0.05). These results indicate that nano-anatase TiO₂in higher dose caused metabolism imbalance of lipids HDL-C and low-density LDL-C in mice liver.

The histological photomicrographs of the liver sections are shown in Fig. 2. In the 5 mg/kg BW nano-anatase TiO₂-treated group, the liver tissue had no abnormal pathology changes compared with the control. In the 100, 150 mg/kg BW nano-anatase TiO₂-treated groups and 150 mg/kg BW bulk TiO₂-treated group, however, the significant histopathological changes were observed in the liver tissue, for example, congestion of vascellum and prominent vasodilatation were observed in 100 mg/kg BW nano-anatase TiO₂-treated group (Fig. 2c), and wide-bound basophilia and focal ischemia occurred in 150 mg/kg BW nano-anatase TiO₂-treated group (Fig. 2d, e), and congestion of central veins was showed in 150 mg/kg BW bulk TiO₂-treated group (Fig. 2f).

Ultrastructure of hepatocyte in female mice is shown in Fig. 3. It was observed that the ultrastructure of hepatocyte from 5 mg/kg BW nano-anatase TiO₂-treated group was similar to the control, but from 100 mg/kg BW nano-anatase TiO₂-treated group turned tumescent mitochondria and vacuolization, and 150 mg/kg BW nano-anatase TiO₂-treated group indicated apoptotic body. The results suggested that nano-anatase TiO₂could damage the structure of hepatocyte of mice.

The inflammation happened in liver according to the histopathological and hepatocyte ultrastructure observations. To confirm the role of inflammatory cytokine pathway in nano-anatase TiO₂-induced liver injury, real-time quantitative RT-PCR, and ELISA were used to demonstrate inflammatory cytokines (such as NF-κB, MIF, IL-6, IL-1β, CRP, TNF-α, IL-4, and IL-10) induction in nano-anatase TiO₂-treated mice.

Real-time quantitative RT-PCR analysis showed that NF-κB, MIF, IL-1β, IL-6, CRP, TNF-α, IL-4, and IL-10 were significantly up-regulated in the liver tissues of mice treated with nano-anatase TiO₂for consecutive 14 days (p < 0.05 or 0.01). The 150 mg/kg BW bulk TiO₂microparticles (micro TiO₂) had less effect on induction of these genes compared with 150 mg/kg BW nano-anatase TiO₂particles (Table 3).

The nano-anatase TiO₂-induced inflammatory cytokine expression was also examined at the protein level after intraperitoneal injection with various doses of nano-anatase TiO₂suspensions for consecutive 14 days (Fig. 4). ELISA analysis showed that nano-anatase TiO₂caused significant induction of serum levels of NF-κB, MIF, IL-6, IL-1β, CRP, TNF-α, IL-4, and IL-10 protein in a dose-dependent manner (Table 4,p < 0.05 or 0.01), which might be produced mainly by infiltrating macrophages and some liver epithelial cells.

The results mentioned earlier are consistent with that the histological photomicrograph and hepatocyte ultrastructure of the liver sections was observed in the treated mice. The inflammation is able to induce an increase of the expression level of inflammatory cytokines by nano-anatase TiO₂.