The HCT116 and SW480 human colon cancer cell lines were obtained from American Type Culture Collection (Manassas, VA), and the p21 derivative of HCT116 cell line was provided by Dr. Bert Vogelstein (Johns Hopkins University, Baltimore, MD). The immortalized human fibroblast cell line MRC5 VA was obtained form the CRUK London Laboratories Cell Repository.

Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS). For experiments using thymidine, dialyzed FBS was used to remove deoxynucleosides in the serum that might interfere in the response to this agent. Replication inhibitors thymidine and hydroxyurea (HU) were used at a concentration 2 mM. For some experiments cells were irradiated using a CIS IBL 437 Cs-137 irradiator. In some experiments a chemical inhibitor of Chk1 activity (Gö6976, Calbiochem, La Jolla, CA; Kohn et al., 2003) was used at concentrations 0.1 or 1 μM. The inhibitor was added to cell cultures 1 h before treatment with replication inhibitors.

The Chk1 small interfering RNA (siRNA) was designed by J. Blackburn and C. Smythe, having the following sequence (sense strand: GAAGCAGUCGCAGUGAAGA). For Cdc45 depletion two different sets of siRNAs were used. The first set (L-003232-00; Dharmacon, Lafayette, CO) consisted of a pool of four small interfering RNA (siRNA) doublexes with the following sense sequences: GUCAAUGUAUACAACGAUAUU, CGUCAGCCAUGGUGAUGUUUU, UCACUCAAAUGAAAUACGUUU, and GCAAAGAGUUCUACGAGGUUU. The second set (HSS112144, HSS112145, and HSS112146; Invitrogen, Paisley, United Kingdom) consisted of a pool of three stealth siRNA doublexes with the following sense sequences: GACGUGGUCUUUGCCACCAUGUCUU, GGCACUCCAGAUGUCAUGCUGUUCU, and GACAGCCUGUGCAACACCAGCUAUA.

Control siRNAs, containing nonspecific sequences that do not have homology in human genome, were provided by Eurogentec (Hythe Southampton, Hampshire, United Kingdom; OR-0030-NEG) or Invitrogen (Stealth siRNA Negative control 12935-400). siRNA and/or Stealth siRNA duplexes were transfected into cells using Lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. The cells were then incubated for 24 h before further treatment.

Cell cycle analysis of floating and adherent cells was performed as described previously (Rodriguez and Meuth, 2006).

Pellets of floating and adherent cells were washed with PBS, fixed in 70% ice-cold ethanol, and stored at −20°C for up to 2 wk. After two washes with PBS, cells were incubated for 15 min on ice in hybridization buffer (PBS containing 0.5% bovine serum albumin [BSA] and 0.25% Triton X-100). After centrifugation, cells were hybridized with an Alexa 488–conjugated rabbit monoclonal anti- γH2AX antibody (Cell Signaling, Beverly, MA; 9719) diluted at a ratio of 1:10 in hybridization buffer, and incubated for 1 h in the dark at room temperature (RT). Cells were then rinsed twice with PBS containing 0.25% Triton X-100 and stained with PI solution (PBS containing 5 μg/ml PI, 100 μg/ml RNAse A) for 30 min before flow cytometry.

For γH2AX foci staining, cells were grown on glass coverslips, treated as indicated, fixed with 3% buffered paraformaldehyde for 15 min at RT, and permeabilized in PBS containing 0.5% Triton X-100 for 8 min at RT. Cells were then incubated with 1:500 diluted polyclonal anti-γH2AX antibody (Cell Signaling; 2577) for 45 min at RT and detected with a secondary Alexa 488–conjugated goat anti-rabbit IgG (A11008; Molecular Probes, Invitrogen, Eugene, OR). Antibody dilutions and washes after incubations were performed in PBS containing 0.5% BSA and 0.05% Tween 20. Coverslips were finally mounted in Vectashield mounting medium with DAPI (H-1500; Vector Laboratories, Burlingame, CA).

For simultaneous analysis of TUNEL+ cells and γH2AX, cells were cultured, fixed, and permeabilized as described above. Then, the TUNEL assay was performed according to the manufacturer's instructions (ApoAlert DNA Fragmentation Assay Kit; Clontech, A Takara Bio, Palo Alto, CA). At the end of this assay, cells were washed with PBS containing 0.25% Triton X-100 for 5 min at RT and further stained with the anti-γH2AX antibody specified above for 45 min, followed by a 30-min staining with a secondary Alexa 594–conjugated goat anti-rabbit IgG (A110012; Molecular Probes, Invitrogen). For simultaneous detection of γH2AX and the activated form of caspase-3, cells were cultured on glass coverslips and treated with siRNAs and replication inhibitor according to standard procedures. At the end of the treatments, cells washed twice with PBS and incubated with the FITC-conjugated caspase-3 inhibitor DEVD-FMK (CaspGLOW fluorescein active caspase-3 kit; MBL, Woburn, MA), at a dilution of 1:300, at 37°C for 1 h. They were then washed twice with PBS and fixed, permeabilized, and stained for γH2AX as described above.

For double staining of γH2AX with RPA, cells were preextracted with PHEM buffer (45 mM HEPES, pH 6.9, 45 mM PIPES, pH 6.9, 10 mM EGTA, pH 7.0, 5 mM MgCl₂) containing 0.1% Triton X-100 and 1 mM PMSF for 1min at RT before being fixed, permeabilized, and stained as described above. For RPA detection, mouse anti-RPA34 (NA19L; Calbiochem) was used at a dilution of 1:500 and detected with a secondary Alexa-594–conjugated goat anti-mouse IgG (A11005; Molecular Probes, Invitrogen).

Immunofluorescence was visualized using a Nikon Eclipse T200 inverted microscope (Melville, NY), equipped with a Hamamatsu Orca ER camera (Bridgewater, NJ) and a 200 W metal arc lamp (Prior Scientific, Cambridge, United Kingdom), with a 100× objective. Images were captured as wide-field acquisitions, analyzed by Volocity 3.6.1 software (Improvision, Coventry, United Kingdom) and further processed with ImageJ software (http://rsbweb.nih.gov/ij/). At least 300 cells were analyzed for each individual experiment, and experiments were repeated twice. In experiments where the fraction of colocalized foci were measured, HCT116 Chk1-depleted cells treated for 6 h with thymidine were used (after longer exposures to thymidine the γH2AX signal becomes considerably diffused). At least 100 cells were analyzed from wide-field acquisition overlays. The colocalization factor was defined as previously described by Sengupta et al. (2004): [(fraction of cells having colocalization) × (fraction of foci colocalized per cell)] × 100.

Whole-cell extracts were prepared and fractionated by SDS-PAGE before being blotted onto nitrocellulose (Whatman Schleicher & Schuell, Dassel, Germany) as described previously (Bolderson et al., 2004). Proteins were detected with the ECL detection system (GE Healthcare, Little Chalfont, Buckinghamshire, United Kingdom) using the following specific antibodies: γH2AX (2577; Cell Signaling), Chk1 (2360; Cell Signaling), β-actin (A-5060; Sigma-Aldrich), RPA34 (NA19L; Calbiochem), cleaved caspase-3 (ab32042; Abcam, Cambridge, United Kingdom), Cdc45 (sc-20685; Santa-Cruz Biotechnology, Santa-Cruz, CA), p21 Waf1/Cip1 (2947; Cell Signaling), phospho-ATM (Ser1981; 2152-1; Epitomics, Burlingame, CA), phospho-Chk2 (Thr68; 2661; Cell Signaling), and phospho-Chk1 (Ser295; 2349; Cell Signaling). Band intensities on the Western blots were quantified by densitometry using the ImageJ software. Relative total Chk1 levels were normalized to corresponding β-actin levels. Subsequently, Chk1 depletion efficiencies are given relative to total Chk1 levels in control untreated cells.

To determine the effect of Chk1 depletion on the induction of H2AX phosphorylation after DNA replication stress, HCT116 cells treated with control or Chk1 siRNAs were exposed to thymidine or HU for up to 48 h. At various times cell extracts were prepared from these cultures, and γH2AX, RPA34, and active caspase-3 were analyzed by Western blotting. Cells treated with the control siRNA showed a transient induction of γH2AX at 16–24 h after treatment with thymidine or HU (Figure 1, A and B). At later times γH2AX levels decreased before increasing again at ∼48 h after treatment with replication inhibitor, most likely in response to DNA fragmentation that occurs in some of the cells (Rogakou et al., 2000). In Chk1-depleted cells this phosphorylation could be detected at about the same time (16 h) but was distinctly stronger and more persistent. γH2AX accumulation coincided with the hyperphosphorylation of RPA34 and occurred well in advance of caspase-3 activation. The high level of γH2AX in Chk1-depleted cells treated with replication inhibitors was not limited to HCT116 as SW480 and MRC5 cells depleted of Chk1 showed a similar induction of γH2AX and RPA34 phosphorylation after thymidine treatment (Supplemental Figure S1, A and B). Additionally enhanced levels of γH2AX and RPA hyperphosphorylation were detected after thymidine exposure of HCT116 cells treated with a Chk1 inhibitor (Gö6976) that has been shown to mimic the effects of the Chk1 siRNA (Sidi et al., 2008; Beckerman et al., 2009; Supplemental Figure S1C).

The level of γH2AX accumulating in Chk1-depleted cells treated with thymidine was clearly elevated relative to cells exposed to IR (Figure 1C). Interestingly Chk1 status did not affect the level of γH2AX in IR-treated cells and RPA hyperphosphorylation was not detected in any of the cells exposed to IR. The timing of H2AX phosphorylation in control or Chk1-depleted cells exposed to IR was distinctly different from that found in cells treated with replication inhibitors (Supplemental Figure 2A). After a 10-Gy dose of IR, HCT116 cells showed a rapid but transient induction of H2AX phosphorylation detectable as early as 30 min after treatment that persisted up to 2 h.

To further characterize the kinetics of H2AX phosphorylation during replication stress, we used flow cytometry to measure the fraction of HCT116 cells containing γH2AX and DNA content. Consistent with the Western blots presented above, ∼8% of HCT116 cells treated with the control siRNA showed γH2AX induction at 16 h after thymidine exposure (Figure 2, A and B). In Chk1-depleted HCT116 cells treated with thymidine a significantly higher proportion of cells showed H2AX phosphorylation (35–60%) at 16–48 h of exposure (Figure 2, A and C). This was not due to the accumulation of cells in S-phase as there was no significant difference in cell cycle distribution in cells treated with control or Chk1 siRNAs (Figure 2, B and C, middle panels).

PI staining revealed that, in the absence of Chk1, γH2AX accumulates in cells at the G1/S border and in S-phase at 16 to 24 h after thymidine treatment (Figure 2C, bottom panel). After longer exposures to thymidine (30 and 48 h), γH2AX appears mainly in S-phase cells, coinciding with the movement of the cell population into S-phase. In contrast, H2AX phosphorylation in control cells was spread throughout all phases of the cell cycle with the greatest density of positive cells in G2/M after 48-h thymidine arrest (Figure 2B, bottom panel).

The above FACS analysis also revealed the accumulation of cells with a subG1 DNA content in Chk1-depleted cultures after 30 h of thymidine treatment (Figure 2, A and C), consistent with the detection of activated caspase-3 at this time in the Western blots (Figure 1A). Because both of these measures of apoptosis occurred much later than γH2AX induction, it seemed unlikely that the H2AX phosphosphorylation observed at early times was a result of the DNA fragmentation that occurs as cells undergo apoptosis (Rogakou et al., 1999). Interestingly only a small proportion (7.9%) of Chk1-depleted cells with a subG1 DNA content had an increased level of γH2AX after a 48-h thymidine treatment (Figure 2C, top panels, UL). To further confirm the late onset of apoptosis, we measured in vivo activation of caspase-3 in a FACS-based assay and TUNEL+ cells under the above conditions of replication stress. The fraction of cells with active caspase-3 showed little change after thymidine treatment of Chk1-depleted cells until 36 h, when a robust increase was detected (Supplemental Figure S3A). There was relatively little increase in the fraction of cells staining for active caspase-3 after treatment with the control siRNA or in cells treated with either siRNA in the absence of thymidine. Similarly there was a significant increase in the fraction of TUNEL+ cells in Chk1-depleted HCT116 cultures treated with thymidine at 48 h (Supplemental Figure S3B). Thus the induction of γH2AX formation significantly preceded the onset of apoptosis.

Given the localization of γH2AX to foci at sites of damage after IR, we next investigated the nuclear organization of γH2AX in Chk1-depleted cells treated with replication inhibitors.

In HCT116 cells treated with the control siRNA, low levels of γH2AX foci (1–10/cell) were detected after 6 h of thymidine treatment, and the fraction of such cells continued to increase through 24 h (Figure 3A and B). Cells with higher levels of foci were less common at all times. In Chk1-depleted cells, varying patterns of nuclear H2AX phosphorylation were detected after thymidine arrest (Figure 3, A and B, Supplemental Figure S4). After a 6-h exposure some cells stained weakly and had few foci (1–10 foci), whereas others had widespread foci (>10/cell) and more intense staining. In addition a small fraction of cells showed diffuse, bright pan-nuclear staining (Figure 3A). This heterogeneity might reflect a difference in staining in cells in early or late S-phase (Cowell et al., 2007). The frequency of cells showing pan-nuclear staining markedly increased after longer exposure times (16 and 24 h) in the absence of Chk1. Cells with >10 foci also increased while those with <10 foci decreased at 24 h. A similar response was seen in HCT116 cells treated with the Chk1 inhibitor Gö6976 (data not shown).

Immunofluorescence analysis was next performed to investigate the relationship between RPA foci that form in Chk1-depleted cells treated with replication inhibitors (Rodriguez et al., 2008) and γH2AX foci. At early times after thymidine treatment when the foci were distinct (6 h, Figure 3B), 92% of cells with RPA and γH2AX foci showed colocalization, and 73% of the foci in these cells were colocalized. However, RPA foci were detected before the appearance of the γH2AX foci. Cells that showed pan-nuclear staining of γH2AX also showed similar staining patterns for RPA.

We also determined the frequency of cells staining for γH2AX foci formation and TUNEL+ (Figure 3C). Although 53.4% of the Chk1-depleted cells showed γH2AX foci after a 48-h thymidine treatment and 12.6% were TUNEL+, only 3.6% stained for both. Thus the dramatic increase in H2AX phosphorylation in Chk1-depleted cells preceded the onset of apoptosis, but our results suggest that enhanced γH2AX is not an indicator of cellular commitment to apoptosis.

H2AX phosphorylation and foci formation occur transiently in cells exposed to IR, and this has previously been shown to reflect the time required to repair DSBs induced by this agent (Rogakou et al., 1999). In control or Chk1 siRNA-treated HCT116 cells, γH2AX foci formed at 15–90 min after IR exposure (Supplemental Figure S2, B and C). Interestingly these radiation-induced γH2AX foci do not colocalize with RPA. Thus the kinetics of γH2AX induction and localization are distinctively different for Chk1-depleted cells exposed to IR relative to those exposed to replication inhibitors.

We previously reported that RPA foci and apoptosis induced in Chk1-depleted cells treated with replication inhibitors could be suppressed by depletion of Cdc45 (Rodriguez et al., 2008). To determine whether the induction of γH2AX was also suppressed under these conditions, HCT116 cells were codepleted of Chk1 and Cdc45 and treated with thymidine for 24 or 48 h. Cells were then harvested and analyzed for γH2AX and RPA34 by Western blotting, or cells were fixed and stained for γH2AX foci formation. We previously showed that siRNA-mediated depletion of Cdc45 slightly slowed progression through S-phase but did not significantly affect cell viability in colony forming assays or induce apoptosis. Similarly Cdc45 depletion did not stimulate H2AX phosphorylation or RPA34 hyperphosphorylation in control or thymidine-treated cells (Figure 4A). However the robust induction of γH2AX and hyperphosphorylation of RPA seen in the Chk1-depleted cells in the presence of thymidine were reduced to control levels in codepleted cells (Figure 4A). Similar effects on γH2AX formation and RPA hyperphosphorylation were seen in Chk1-depleted HCT116 cells treated with a second Cdc45 siRNA and in cells treated with the Chk1 inhibitor Gö6976 instead of the siRNA (Supplemental Figure S5, A and B). Cdc45 depletion also suppressed γH2AX induction and RPA hyperphosphorylation in SW480 cells depleted of Chk1 (Supplemental Figure S5C).

To confirm this, we next examined the nuclear distribution of γH2AX in HCT116 cells transfected with control or Chk1 siRNAs after a 24-h treatment with thymidine (Figure 4, B and C). During unperturbed DNA replication, depletion of Cdc45 produced a low level of cells staining weakly (1–10 foci) for γH2AX fluorescence relative to control or Chk1-depleted cells that may reflect the slower progression through S-phase seen in such cells. This increase was not as pronounced in cells codepleted of Cdc45 and Chk1. After a 2-h exposure to thymidine, the percentages of Cdc45-depleted cells with γH2AX foci (weakly staining with 1–10 foci or showing more intense staining with >10 foci) were slightly higher than thymidine-treated control cells. Cells with pan-nuclear staining were not detected. Chk1 ablation dramatically increased the fraction of cells with >10 foci and those showing pan-nuclear staining after thymidine treatment. Codepletion of Chk1 and Cdc45 reduced the formation of γH2AX nuclear foci in arrested cells but more dramatically reduced the fraction of cells with pan-nuclear staining relative to cells treated with Chk1 siRNA. The proportion of cells staining weakly for γH2AX (<10 foci) increased in the codepleted cells relative to cells depleted of Chk1 alone but remained at the level of the control.

We also used flow cytometry to measure γH2AX and DNA content in cells depleted of Chk1 and/or Cdc45. These analyses showed that the γH2AX-positive cells that were lost after codepletion of Chk1 and Cdc45 and thymidine treatment were mainly in S-phase (Supplemental Figure S6). Collectively, the above data from immunofluorescence and FACS analyses verified the suppressive effect of Cdc45 depletion on the enhanced induction of γH2AX during replication stress in the absence of Chk1. Moreover, they indicate that the pan-nuclear distribution of γH2AX occurring in Chk1-depleted cells is particularly dependent on Cdc45 function during S-phase.

In contrast HCT116 cells deficient in p21, a negative regulator of replication origin firing, showed a more robust γH2AX induction after treatment with the Chk1 siRNA or the Chk1 inhibitor Gö6976 and exposure to thymidine relative to p21+/+ cells (Figure 4D).

To further investigate the role of γH2AX in the Chk1 suppressed pathway, we measured γH2AX levels and foci in control and Chk1-depleted cells released from thymidine treatment. We first determined the reversibility of thymidine treatment in control and Chk1-depleted HCT116 cells. DNA content in such cells was measured by FACS after continuous exposure to thymidine for 24, 32, 40, 48 or 64 h and in cultures exposed to thymidine for 24 h and then released into thymidine-free medium for 8, 16, 24 or 40 h. Control cells continuously exposed to thymidine slowly traversed S-phase and accumulated in G2 after 64-h exposure (Supplemental Figure S7). When these cells were released from thymidine after 24 h, they reentered the cell cycle and after 16 h showed a profile similar to that of untreated cells. Chk1-depleted cells showed a similar slow transition through S-phase in the presence of thymidine; however, by 40 h 27% of cells showed a subG1 DNA content, and fewer cells remained in S and G2. In Chk1-depleted cultures released into thymidine-free medium after 24 h, many cells failed to reenter the cell cycle and remained in S-phase, and 16 h after release 24% showed a subG1 DNA content, much like the cultures continuously exposed to thymidine. Measurements of activated caspase-3 together with DNA content verified the apoptotic response of Chk1-depleted cells during recovery from a 24-h thymidine arrest (Supplemental Figure S8). After Chk1 ablation, activation of caspase-3 was detected in S-phase during and after replication stress (31 and 24% of total cells, respectively). In contrast, both control and Chk1 siRNA-treated cells were able to reenter the cell cycle after release from a shorter (6 h) treatment with thymidine (Supplemental Figure S9A) although after a 16-h thymidine treatment the Chk1-depleted cells were largely committed to apoptosis (Supplemental Figure S9B).

We then analyzed the ability of Chk1-depleted cells to resume DNA synthesis after release from thymidine (Figure 5A). Chk1 depletion had little effect on BrdU incorporation in the absence of replication stress, with 44% of cells treated with the control siRNA and 39% of cells depleted of Chk1 incorporating BrdU in a 1-h pulse (Figure 5, B–D). To determine the effect of replication stress in such cells, control or Chk1 siRNA-treated HCT116 cells were exposed to thymidine for 24 h, before being shifted to thymidine-free medium and pulsed with BrdU for 1 h and then left to cycle for 2, 4, 6, or 20 h in thymidine- and BrdU-free medium before harvest for FACS analysis of DNA content and BrdU incorporation. In HCT116 cultures exposed to thymidine for 24 h before release, BrdU incorporation was detected in 86% of cells treated with the control siRNA and in 72% of Chk1-depleted cells. In control cultures the BrdU-positive cells progressed through S-phase and after 6 h, 69% of them were in G2. In the absence of Chk1, S-phase progression was delayed in BrdU-labeled cells. By 6 h, only 33% progressed to G2 phase. In cultures left to grow for 20 h after BrdU labeling, control cells showed a more normal cell cycle distribution, with 45% of the BrdU-labeled cells traversing the cell cycle to G1. In contrast a smaller proportion of BrdU-labeled Chk1-depleted cells appeared in G1 (22%), whereas most remained in S and G2. In addition nearly 20% of cells from these cultures had a subG1 DNA content. Thus Chk1-depleted cells show a strongly reduced capacity to reenter and traverse S-phase and a greater commitment to death after a 24-h exposure to thymidine, relative to control cells. A high proportion of Chk1-depleted cells incorporate BrdU after release but, given the reduced transition through S-phase, this may not represent the resumption of synthesis at stalled forks in some of these cells.

SW480 cells show a similar ability to rapidly reenter S-phase after thymidine or HU treatment (Supplemental Figure S10, A and B). On release from thymidine a high proportion incorporate BrdU in a 1-h pulse. By 4 h most of these cells traversed S-phase and entered G2, and by 24 h a cell cycle profile typical for growing cells is restored. For Chk1-depleted SW480 cells, a much smaller proportion reenter S-phase. Strikingly, a large number of cells with an S-phase DNA content fail to incorporate BrdU in the 1-h pulse. By 4 h after release there is very little change in the cell cycle profile, and only a small proportion of the cells incorporating BrdU appear to have progressed to G2, and by 24 h after release there is still little change in the cell cycle profile suggesting that only a fraction of the cells incorporating BrdU have resumed growth. SW480 cells released from HU show a slower reentry into S-phase. At 4 h the cells largely remain in S-phase and 40% are in G2 at 24 h. In Chk1-depleted SW480 cells only 15–16% incorporate BrdU after the 24-h exposure to HU and the cell cycle profile is largely unchanged over 24 h. Thus like HCT116 cells, Chk1-depleted SW480 cells show a strongly reduced ability to reenter and traverse S-phase after release from treatment with replication inhibitors.

We next examined γH2AX status in cells released from thymidine treatment. HCT116 cells transfected with control or Chk1 siRNAs and exposed to thymidine for 24 h were released into thymidine-free medium or left to grow in the inhibitor for another 24 h before harvest. Western blot analysis of total protein extracts from the above cultures showed a decrease in the level of γH2AX in Chk1-depleted cells released from thymidine although it remained considerably higher than in control cells treated with thymidine. Hyperphosphorylated RPA34 showed a gradual decline and was barely detectable at 24 h after release (Figure 6A). This is accompanied by a sustained activation of ATM (in the form of pSer1981 ATM) and Chk2 (pThr68 Chk2) in the thymidine-released cells. A similar pattern of sustained activation of H2AX, ATM, and Chk2 were also found in Chk1-depleted HCT116 cells treated with HU for 24 h and then released (data not presented) and in SW480 cells treated with thymidine or HU for 24 h and then released (Supplemental Figure S11A).

In addition we measured γH2AX foci in Chk1-depleted cells recovering from thymidine arrest (Figure 6, B and C). After release from a 24-h thymidine treatment the fraction of cells showing >10 γH2AX foci decreased slightly, whereas there was a larger fall in the fraction of cells showing pan-nuclear γH2AX staining. We further measured the levels of γH2AX accumulation in Chk1-depleted HCT116 cells together with DNA content by flow cytometry as described above (Figure 6D). This analysis revealed that the fraction of cells positive for γH2AX showed a progressive decline at 24 and 40 h after release relative to the fraction measured before release (Figure 6, D and E), whereas only a small proportion of control cells showed γH2AX under the same conditions. Interestingly only a very small proportion of cells staining for increased γH2AX (0.39–0.55%) had a subG1 DNA content at 24 or 40 h after release even though the percentage of total cells in these cultures with a subG1 DNA content was significantly higher at these times relative to the Chk1-depleted cells treated with thymidine for 24 h (Figure 6, D and E). Chk1-depleted SW480 cells produced similar results with respect to γH2AX foci after thymidine treatment (Supplemental Figure S11, B and C) and FACS-based analysis of γH2AX levels after thymidine or HU (Supplemental Figure S11D). Taken together these data indicate that γH2AX persists in a high proportion of Chk1-depleted cells released from thymidine, although our data indicate that some dephosphorylation of γH2AX and loss of foci occurs in these cells. Furthermore, cells containing elevated levels of γH2AX have a low level of apoptosis.

Most of the cells having increased γH2AX after exposure to thymidine for 24 h had a G1/S-phase DNA content, whereas the cells released from thymidine for 24 h showed a broader distribution (Figure 6D). This is similar to our previous observation that Chk1-depleted cells labeled with BrdU showed a prolonged transition through S-phase after release (Figure 5C). In view of the slow transition of γH2AX-positive cells through S-phase during recovery from thymidine arrest in the absence of Chk1 despite the incorporation of BrdU in a high proportion of cells in these cultures, we next examined BrdU incorporation in cells containing γH2AX foci by immunofluorescence. In Chk1-depleted cultures treated with thymidine for 16 h and then released into thymidine-free medium containing BrdU, only 16% of total cells stained for both γH2AX and BrdU incorporation (Figure 7, A and B). Strikingly, BrdU incorporation was detected in only 35% of all cells showing γH2AX foci and not at sites of these foci (Figure 7A and B). Additionally, 54% of cells showed BrdU incorporation but no γH2AX foci and 30% showed only γH2AX foci.

Very similar responses were found with Chk1-depleted SW480 cells (Figure 7C). Only ∼19% of Chk1-depleted cells showed both γH2AX foci and BrdU incorporation and, as with HCT116 cells, BrdU incorporation was not detected at sites of γH2AX foci. As found previously a lower percentage of Chk1-depleted SW480 cells incorporated BrdU after release from thymidine.

Similarly RPA foci found in Chk1-depleted HCT116 cells after 16-h thymidine treatment and release into medium containing BrdU do not colocalize with sites of BrdU incorporation (Figure 7D). However consistent with earlier results, the RPA foci detected in these experiments show a high level of colocalization with γH2AX foci (Figure 7E).

FACS analysis of γH2AX levels and DNA content revealed that cells with a subG1 DNA content did not contain enhanced levels of γH2AX (Figure 6D). To further examine the relationship between γH2AX and the induction of death by replication inhibitors in Chk1-depleted cells, we measured caspase-3 activation in cells showing γH2AX induction. HCT116 cells treated with control or Chk1 siRNAs were exposed to thymidine for 24 or 48 h or treated with thymidine for 24 h and released into thymidine-free medium for 24 h before being fixed and stained for activated caspase-3, γH2AX, and DNA content by immunofluorescence analysis as described above. Chk1-depleted cells showing activated caspase-3 did not stain for γH2AX, whereas those staining for γH2AX did not show activated caspase-3 (Figure 8A).

Taken together our data suggest that γH2AX foci persist at stalled forks in cells showing aberrant progression through S-phase in the absence of Chk1. This is accompanied by chronic activation of the ATM-mediated signaling cascade but not the induction of apoptosis.