To study the role of p300 in HFK differentiation, we knocked down endogenous p300 by using two retrovirally expressed shRNA molecules directed against p300 and a scrambled control. Western blot analysis indicated that levels of p300 were decreased significantly in both p300 knockdown lines (∼80%) (Figure 1A). Scramble and shp300 cell lines were then treated with calcium to induce differentiation and harvested at indicated time points. In control cells p300 dependent acetylation of p53 on K382 was observed, but this is absent in p300 depleted cells due to the significant reduction in p53 protein levels (Figure 1A). These experiments were carried out 3 times with different batches of HFKs and we always observed a decrease in p53 protein levels in p300 depleted cells, although mRNA levels were unchanged compared to control cells (Figure S1). Depletion of p300 also reduces the expression of early differentiation marker, keratin 1 (K1) and p21^Waf1/CIP1 during calcium treatment (Figure 1B). We have only shown results with one of the shRNA molecules as the outcome with the other was similar. Reduced levels of induction of differentiation markers was also observed in organotypic raft cultures, where knockdown of p300 resulted in reduced expression of K1 (early marker) and filaggrin (late marker) (Figure 2A). There was also an increase in proliferation of HFKs in the basal layer of the raft cultures in the knockdown cells (Figure 2A and B). Moreover, we transiently knocked down the expression of p300 or CBP with short interfering RNA (siRNA) molecules and induced the cells to undergo differentiation. Strikingly, depletion of p300, but not CBP, down-regulated the p300 dependent p53 protein levels, which in turn reduced the expression of p21^Waf1/CIP1 and K1 in differentiating keratinocytes (Figure S2). Since p300 depleted cells expressed normal levels of CBP in differentiation, these results suggest that p300, but not CBP, plays a role in keratinocyte differentiation.

To further study the effects of p300 on cell proliferation we investigated firstly, the effects on proliferation in cycling cells and secondly, if there was an increase in the life span of p300 depleted cells. There was an increase in bromodeoxyuridine (BrdU) uptake in p300 depleted cycling cell (Figure 3A) and also a significant increase in life span, with depleted cells going through senescence after 40 population doublings as opposed to control cells which went though senescence around 25 population doublings (Figure 3B). This result is an average of three experiments using different batches of keratinocytes.

Since p300 depletion causes inhibition of differentiation and increased proliferation of cells we reasoned that it may also allow cells to escape from the permanent cell cycle arrest that is required for terminal differentiation of keratinocytes. p300 depleted cells were calcium treated to induce differentiation and after 48 hours the cells were placed in growth medium to determine the capability to re-enter the cell cycle as measured by BrdU uptake. Approximately 25% of depleted cells did not completely exit the cell cycle after 48 hours in calcium while all control cells had exited the cycle (Figure 3C). When after 48 hours in differentiation medium, cells were transferred to growth medium for 24 hours, many p300 depleted cells re-entered the cell cycle compared to control cells (Figure 3C, t = 48+24). To determine if the cells that re-enter the cycle are viable, we replated cells in growth medium and allowed the cells to grow for 7 days. A significant proportion of the p300 depleted cells, but not the control cells, that re-entered the cycle were viable and grew into colonies (Figure 3D).

To try and understand the mechanism by which p300 depletion causes an increase in proliferation, we determined whether p300 regulation of p21^Waf1/CIP1 expression was important. Scramble and shp300 expressing cells were transiently transfected with a pGL-3 plasmid carrying the human p21^Waf1/CIP1 promoter and cells were either kept in normal calcium medium (60 µM) or exposed to high calcium concentrations (1.5 mM) for the indicated time points. Luciferase assays showed that the knockdown of p300 down-regulated p21^Waf1/CIP1 promoter activity during keratinocyte differentiation compared to that of the scramble control (Figure 4A). Also, real-time RT-PCR confirms that depletion of p300 significantly reduces p21^Waf1/CIP1 mRNA during keratinocyte differentiation (Figure 4B), indicating that p300 is important for transcriptional regulation of p21^Waf1/CIP1 during differentiation. Others have shown that the two p53 binding sites are important for p21^Waf1/CIP1 transcription and we have found the same requirement in differentiating keratinocytes (Figure S3).

Since p300 can bind and acetylate p53 to activate p21^Waf1/CIP1 expression during DNA damage and p300 and p53 are required for p21^Waf1/CIP1 transcription, we studied the ability of p300 to bind p53 response elements in differentiating cells by using chromatin immunoprecipitations. Keratinocyte DNA was PCR amplified with primers specific for sequences that flank the two p53 response elements (RE1 and RE2). As a control for non-specific binding during immunoprecipitation, cross-linked lysates were immunoprecipitated with mouse or rabbit monoclonal IgG antibodies. ChIP analysis revealed that p53 bound strongly to RE1 and RE2 when cells were confluent (t = 0) and persisted during differentiation (Figure 4C). Unlike p53, p300 bound to both RE1 and RE2 only during differentiation (Figure 4C). To confirm that p300 requires p53 to bind to the p21^Waf1/CIP1 promoter, we stably knocked down the expression of p53 in HFK by using retroviral vector (shp53) and Western blot analysis confirmed that the level of p53 was significantly reduced (∼80%) (Fig. 4D). Interestingly, knock-down of p53 also reduced the expression of p21^Waf1/CIP1 during early differentiation (Fig. 4D). ChIP analysis indicated that depleting p53 inhibited p300 binding to both RE1 and RE2 during differentiation (Figure 4C). These results suggest that induction of p21^Waf1/CIP1 in early differentiation is regulated by p300 dependent activation of p53.

Earlier work suggests that p21^Waf1/Cip1 has a dual role in mouse keratinocyte proliferation and differentiation [12]. To determine the role in HFKs, cells were transfected with two siRNA molecules targeting p21^Waf1/CIP1 and Western blotting of whole cell lysates with p21^Waf'1/CIP1 antibody shows that both siRNA molecules, sip21^Waf'1/CIP1A and sip21^Waf'1/CIP1B, were able to knockdown p21^Waf'1/CIP1 protein levels efficiently (∼90%) (Figure 5A). Transfected cells were induced to differentiate at indicated times and harvested for immunoblotting analysis, which showed that the protein level of K1 was significantly down-regulated in the p21^Waf'1/CIP1 depleted cells (Figure 5B). Also, p21^Waf1/CIP1 depleted cells were more proliferative than control cells as measured by BrdU uptake and a significant number of these cells remained BrdU positive 48 hours after differentiation induced by calcium treatment (Figure 5C). HFKs depleted of p21^Waf1/CIP1 were used to generate organotypic raft cultures and harvested 5 days after lifting to the air-liquid interface. Depletion of p21^Waf1/CIP1 disrupts the formation of granular and cornified layers in the epidermis with reduced K1 expression and increased proliferation in the basal layer, resulting in a thicker epithelium (Figure 5D). Depletion of p21^Waf1/CIP1 increased the number of BrdU positive cells by 70% in the basal layer compared to that of the control (Figure 5D & E). Interestingly, BrdU positive cells were also observed in the suprabasal layer of p21^WAF1/CIP1 depleted raft, indicating that these cells did not exit cell cycle properly as they migrate upwards. To determine whether exogenous expression of p21^Waf1/CIP1 can rescue the proliferation and differentiation defect of p300 depleted cells, we transiently transfected the scramble and shp300 cell lines with either the vector containing human p21^Waf1/CIP1 cDNA with a N-terminal Flag tag or pCMV empty vector as a negative control and the cells induced to differentiate for 48 hours. Western blotting indicates that exogenous expression of p21^Waf1/CIP1 restored the expression of K1 in p300 depleted cells (Figure 5F) and reduced proliferation to the level in control cells (Figure S4). Taken together, our results indicate that p300 may regulate keratinocyte cell growth and differentiation through regulation of p21^Waf1/CIP1.

Primary human foreskin keratinocytes (HFKs) were harvested from neonatal foreskins, cultured in low calcium in Epilife (Casade) and transduced with retrovirus produced in ΦNYX packaging cell line (ATCC) as previously described [31]. The retroviral vectors (scramble, shp300, and shp53) used in this study were purchased from Origene Technologies, U.S.A. For calcium induced differentiation, confluent monolayers of HFKs were induced to differentiate by withdrawal of growth factors and addition of 1.5 mM CaCl₂. Differentiation of HFK cell lines in organotypic raft cultures was carried out as previously described for transduced lines [32]. The raft cultures were harvested, fixed in 4% PFA and then embedded in paraffin for subsequent sectioning and staining with haematoxylin and eosin (H&E). To label cells synthesizing DNA, cultures were pulsed with 10 µM bromodeoxyridine (BrdU) for 20 minutes prior to fixation. For the raft culture, 20 µM BrdU was added to the media 16 hours prior to harvest. For siRNA transfection, complexes are produced by combining 100 pmols of siRNA with 100 µl optimen (Invitrogen) followed by the addition of 3 µl FuGeneHD and incubated at room temperature for 15 minutes prior to addition to cells at a final concentration of 100 nM. Cells were incubated with siRNA/FugeneHD complexes for 6 hours. The sequences of p21^Waf1/CIP1 siRNA molecules were previously described [33], [34]. siGENOME SMART pool p300 and CBP siRNA molecules were purchased from Dharmacon.

HFKs were transiently transfected with the p21^Waf1/Cip1 luciferase reporter constructs as previously described [14]. p21^Waf1/Cip1 promoter deletion luciferase reporter constructs (0-luc to 4-luc) were kindly provided by Dr. Wafik S. El-Deiry [35]. All these constructs were sub-cloned into the XbaI site of pGL-3 basic (Promega), except the 0-luc that was inserted into a blunt-ended Xho1 site of pGL3-basic. p21^Waf1/Cip1-mut1 luciferase report vector construct was kindly provided by Professor Wei-Guo Zhu [36]. pMT5-p21^Waf1/CIP1-Flag over-expression vector was purchased from Addgene. All transfections were performed with Fugene 6 and cells were harvested to 72 hours after transfection. Luciferase measurements were performed by using the dual-luciferase kit (Promega).

RNA extraction was carried out with High Pure RNA isolation kit (Roche) according to manufacturer's instructions. RNA (1 µg) was treated with RQ1 RNAase free DNase (Promega) prior to first stand cDNA synthesis using random primers with transcriptor high fidelity cDNA synthesis Kit (Roche) according to manufacturers instructions. Amplification of PCR products was quantified using FastStart SYBR Green Master (Roche) according to manufacturers instruction and fluorescence montoried on a DNA Engine Peltier Thermal Cycler (Bio-Rad) equipped with a Chromo4 Real-Time PCR Detection System (Bio-Rad) and melting curve analysis also performed. In brief cDNA samples were diluted 1∶10 and quantified by amplification against serial dilutions of appropriate control cDNA with the following cycling conditions: initial denaturation 95°C for 10 minutes, 40 cycles of 95°C-15 seconds, 58°C-15 seconds, 60°C-60 seconds. Expression levels were assessed in triplicate, normalized to large ribosomal protein (RPLPO) levels and graphs represents the combined results of two independent biological replicates. The specific primers for this analysis were as follows: p21^Waf1/CIP1 5′ AGCGGAACAAGGAGTCAG 3′ (sense) and 5′ CGTTAGTGCCAGGAAAGAC 3′ (antisense); p53 5′ CCAGGGCAGCTACGGTTTC′3 (sense) and 5′ CTCCGTCATGTGCTGTGACTG′3 (antisense) [37].

ChIP assays were carried out using ∼2×10⁶ keratinocytes fixed with 1.5% formaldehyde for 20 minutes. Cells were washed twice in ice cold PBS and suspended in collection buffer (100 mM Tris-HCl pH 9.4, DTT 10 mM Protease inhibitors). They were then subsequently washed with 1 mL of NCP1 buffer (10 mM EDTA, 0.5 mM EGTA, 10 mM Hepes pH 6.5, 0.25% Triton X-100) and NCP2 buffer (1 mM EDTA, 0.5 mM EGTA, 10 mM Hepes pH 6.5, 200 mM NaCl) to isolate nuclei. Cells were then spun down and resuspended in 1 mL sodium dodecyl sulfate lysis buffer (0.5% Empigen BB, 1% sodium dodecyl sulfate, 10 mM EDTA, 50 mM Tris-HCL pH 8.0) supplemented with complete protease inhibitor cocktail (Roche), and DNA in the cross-linked preparations was sonicated 6 times for 20 seconds each, to an average fragment size of 500 bp using Sonics Virba Cells Sonicator (24% amplitude) (Sonics & Materials Inc. USA). The insoluble material was removed by centrifugation, and soluble chromatin samples were incubated overnight at 4°C with 2 µg of monoclonal antibodies against p53 (clone DO-1; Santa Cruz Biotechnology), p300 (clone C20; Santa Cruz Biotechnology) or control immunoglobulin G (IgG) and 25 µl of pre-blocked Dynabeads Protein G (Invitrogen), made up to 1 ml final volume with IP buffer (1% Triton X-100, 0.1% sodium deoxycholate, 10 mM EDTA, 50 mM Tris-HCL pH 8.0). The next day, the immune complexes were washed eight times with 1 mL of RIPA buffer (50 mM Hepes pH 8.0, 1 mM EDTA pH 8.0, 1% NP40, 0.7% Deoxycholate, 0.5 M LiCl, Protease inhibitor). Afterwards, the complexes were resuspended in 1 mL of 1X TE buffer and spun down at 3000 rpm for 3 minutes. The samples were then eluted with 50 µl of elution buffer (10 mM Tris pH 8.0, 1 mM EDTA, 10% SDS) at 65°C for 10 minutes vortexing every two minutes during incubation. The eluted samples were spun for 30 second at 15000 rpm and then transferred to fresh tubes. The elution process was repeated and 70 ul elution buffer added. Input templates were purified from 5% of the original lysates in parallel with the eluted immunoprecipitated samples. Cross-linking was reversed by incubating the samples at 65°C for 16 hours. The samples were then purified by using a Qiagen DNA purification kit following the manufacturer's protocol. The recovered DNA (4 µl from 30 µl immunoprecipitated chromatin DNA or 1 µl from the 60 µl input DNA control) was subjected to PCR amplification using GoTaq green Felix PCR reaction kit. The specific primers for this analysis were used as previously described [25], [38], [39].

Cells were plated at 2×10⁵ cells per p60 dish in Epilife media, refed every 2 days, and subcultured 3 days after plating, before growth was slowed by high cell density. Population doublings (PD) per passage was calculated as log₂(number of cells at time of subculture/number of cells plated). Cumulative PD was plotted against total time in culture to determine replicative life span and the onset of senescence.

Protein lysate concentrations were 50 µg for western blots as previously described [40]. The following primary antibodies were used in this study: mouse monoclonal anti-p53 (DO-1 Santa Cruz Biotechnology 1∶1000), mouse monoclonal anti-p21^Waf1/Cip1 (BD Phamingen 1∶1000), mouse monoclonal anti-p300 (1B1 Abnova 1∶500), rabbit polyclonal anti-acetylated p53 (lysine 382, Cell signaling 1∶1000), rabbit polyclonal anti-keratin 1 (Convance 1∶2500), mouse monoclonal anti-Flag (Sigma Aldrich, 1::2000) and mouse monoclonal anti-β-Actin (Sigma 1∶10000). Luminescence was determined by incubation with Chemiluminescence Detection Reagent (PerkinElmer, USA) and exposed using FluorChem SP imaging system (Alpha Innotech, USA).

Tissue embedding and haematoxylin and eosin staining were performed by standard techniques. Images were taken on an Olympus BH-2 microscope with an Olympus D25 camera using Cell B software (Olympus). Five micrometer thick paraffin-embedded sections were deparaffinized with xylene, rehydrated with a series of step down concentration of ethanol and antigen retrieval carried out with boiling 1x antigen retrieval buffer (BioGenex, San Ramon, CA). Briefly, sections were permeabilised with 10%FCS/0.2% Trition X-100 for 30 minutes at room temperature, rinsed and incubated with primary antibody overnight at 4 in 10% FCS. The next day, the sections were washed and incubated with secondary antibody at room temperature for 1 hour, washed and mounted with Prolong Gold antifade reagent plus DAPI (Molecular Probes). The following antibodies were used in this study: mouse monoclonal BrdU (BD Pharmingen 1∶100), mouse monoclonal anti-filaggrin (Neomarkers 1∶50 no retrieval), rabbit polyclonal anti-ki67 (Santa Cruz Biotechnology 1∶100), rabbit polyclonal anti-keratin 1 (Covance 1∶2500 no retrieval), and goat anti-mouse and anti-rabbit secondary conjugated to Alexafluor 488 nm or 594 nm (Molecular Probes 1∶400). BrdU pulsed cells on coverslips were fixed for 15 minutes with 4% formaldehyde, washed 3x with PBS, submitted to antigen retrieval and stained as described above. For raft sections, the number of Ki67 or BrdU positive cells was counted for a minimum of 10 fields of view. For coverslips, a minimum of 10 fields of view and 500 cells were counted on each slide and expressed as percentage of BrdU positive cells (BrdU/DAPI). In all cases, immunofluorescent images were captured on a Leica AF6000 inverted fluorescence microscope and Leica AF imaging software. Exposure times were kept constant within an experiment.