Kinase Assays—To prepare biotinylated α-synuclein substrate, a cysteine residue was introduced into the C terminus (141C-αSyn) of the recombinant α-synuclein expression construct previously described (11), using site-directed mutagenesis (QuikChange XL, Stratagene), and the resulting α-synuclein mutant was prepared (11). The C-terminal cysteine was biotinylated with maleimide-polyethylene glycol 2-biotin (Pierce). PLK1, -2, -3, and -4 (Carna Biosciences) or CK 2 (New England Biolabs) were mixed with 66 nm biotin-141C-α-synuclein (33 nm) and 0.2 mm phospholipid vesicles (75% soybean phosphatidylcholine (Sigma Aldrich), 25% 1-palmitoyl-2-oleoyl-sre-glycero-3-phosphate (Avanti Polar Lipids) in buffer A (25 mm Hepes, pH 7.5, 50 mm NaCl, 2 mm dithiothreitol, 0.1 mg/ml bovine serum albumin). The kinase reaction was started by adding an equal volume of buffer B (25 mm Hepes, pH 7.5, 50 mm NaCl, 2 mm dithiothreitol, 0.2 mm ATP, 0.2 mm MgCl₂) and incubated at 30 °C for 30 min. Europium cryptate-labeled p-Ser-129-specific11A5 antibody (2 nm) and streptavidin-allophycocyanin (7.5 nm) were added in the same reaction volume of buffer C (25 mm Hepes, pH 7.5, 0.8 m KF, 66 nm EDTA, 0.1% bovine serum albumin), and fluorescence intensity was measured. Uniform phosphorylation of the p-Ser-129 α-synuclein standard was confirmed by reverse phase-high pressure liquid chromatography and mass spectroscopy. The p-Ser-129 α-synuclein standard curve was obtained under the same conditions as for measurement of assay samples, without kinase. Unphosphorylated α-synuclein was added to keep the total synuclein constant at 33 nm. For inhibitor studies, compounds were serially diluted in buffer B, with a PLK2 concentration of 0.3 nm.

Targeted Gene Disruption and Generation of Plk2^–/– Mice—plk2^–/– mice were prepared by Caliper Life Sciences. A plk2 targeting construct was designed to replace all 14 plk2 exons (deletion between sequences 5′-CAGCCAGCCGGCGCGTATTTAAAGC-3′ and 5′-AGCACGGGTTCCTGACACGTCAG-3′) with a Neo cassette (targeting vector FtNwCD, Caliper Life Sciences). This targeting construct was used to disrupt the plk2 gene in C57BL6 embryonic stem cells. These embryonic stem cells were injected into blastocysts and implanted into pseudo-pregnant females. Resulting germ line chimeras were crossed to C57BL/6N Tac mice, and heterozygous offspring were intercrossed to produce PLK2-null animals. Similar to a previous report (23), few live plk2^–/– homozygous offspring were observed. Mice were genotyped by PCR using the following primers: 5′-CTGTGCTCGACGTTGTCACTG-3′ and 5′-GATCCCCTCAGAAGAACTCGT-3′ for the disrupted allele and 5′-CTTGCTCGTACTCATCACGGCA-3′ and 5′-AACCTAGTCACTTAGCAATGCCAGGT-3′ for the wild-type allele.

Preparation of Lentiviral Constructs—The lentiviral plasmid designated pAGMK was generated by modifying the parent lentiviral plasmid pCSC-SP-PW-GFP1 (24) as described in the supplemental materials. The cDNA coding for α-synuclein or α-synuclein (E46K) was cloned into pAGMK to replace green fluorescent protein, using the AgeI/PmeI sites. The Plk2 short hairpin RNA (shRNA) containing plasmid (TRCN0000000869, CCGGGTGACGGTGCTGAAATACTTTCTCGAGAAAGTATTTCAGCACCGTCACTTTTT) was obtained from Sigma. The procedures for lentivirus production are described in the supplemental materials. After the total RNA was isolated, the efficiency of mRNA knockdown by shRNA was determined by TaqMan quantitative RT-PCR with the Applied Biosystems Gene-Assay kit using the protocol provided by the supplier. The relative copy number of PLK2 mRNA in the cellular extract was calculated after normalization to a housekeeping mRNA, glyceraldehyde-3-phosphate dehydrogenase.

Cortical Cultures from PLK2 Knock-out Mice—Embryonic day 15 embryos were obtained from heterozygous PLK2 knockout crossed C57Bl6 mice (International Animal Care and Use Convention (IACUC) protocol MO-PH-05-08). Each embryo was placed in a distinct Petri dish for subsequent genotyping analysis as described above. Cultures, at least 95% neuronal, were prepared as described by Wright et al. (25). After 14 days in culture, cells were washed in ice-cold phosphate-buffered saline and lysed in ice-cold cell extraction buffer (CEB; 10 mm Tris, pH 7.4, 100 mm NaCl, 1 mm EDTA, 1 mm NaF, 20 mm Na₂P₂O₇, 2 mm Na₃VO₄, 1% Triton X-100, 10% glycerol, 0.1% SDS, 0.5% deoxycholate). Plates were snap-frozen on dry ice and stored at –80 °C. Duplicate plates from each culture were harvested for qRT-PCR as detailed below. RNA was extracted from samples and purified using the Qiagen RNeasy 96 kit according to the Qiagen protocol.

Transfection of HEK293 Cells—HEK293 cells were co-transfected with pAGMK-α-synuclein (wild type), along with either pCMV6-XL4 empty vector or pCMV6-XL4 vector containing PLK2 (OriGene Technologies, Rockville, MD). Cells were plated at a density of 4,000 cells/well into poly-d-lysine-coated 96-well plates. The following day, growth medium was replaced with 293 medium (Dulbecco's modified Eagle's medium, 10% fetal bovine serum, 20 mm glutamine, 1 mm sodium pyruvate), and cDNAs were incubated at room temperature with Lipofectamine 2000 (Invitrogen) for 15 min prior to transfection with 100 nm siRNA and Lipofectamine 2000 per well following the manufacturer's instructions. Cells were washed in cold phosphate-buffered saline 48 h after transfection and then harvested in CEB. Plates were snap-frozen on dry ice and stored at –80 °C.

Compound Treatment of Swiss-Webster Cortical Cultures and of Transfected HEK293 Cells—Mouse cortical cultures were prepared as described above from embryonic day 15 Swiss-Webster embryos, except that the embryonic cortices were pooled. Cells were maintained for 14 days prior to inhibitor treatment. Transfected HEK293 cells were prepared as described above. The following inhibitors were diluted into medium, and cells were treated for 2 h: BI2536, N-[4-(4-aminothieno[2,3-d]pyrimidin-5-yl)phenyl]-N′-(3-methylphenyl)urea (APMU), and 2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole (DMAT; Calbiochem). After 2 h, cells were washed and lysed as described above.

In Vivo Experiments—Female 9-week-old FVB/N mice (20–26 g each) were purchased from Taconic. All experiments were approved by the IACUC of Elan Pharmaceuticals and conducted in accordance with its guidelines. Drug administration was by intravenous tail vein injection with one 30 mg/kg dose of BI2536 or vehicle at a 5 ml/kg dose volume in 0.9% saline. Animals were euthanized by carbon dioxide 3 h after dosing. Brains were removed, rinsed in 0.9% saline, and separated into left and right hemispheres. The cortex was dissected from the right hemisphere, frozen on dry ice, and kept at –80 °C until used for quantitation of α-synuclein levels.

ELISA Assay—Protein concentration of lysates was measured using the Micro BCA Kit (Pierce Biotechnology). Total α-synuclein and p-Ser-129 α-synuclein levels were each normalized to the total protein measured in each lysate, and a ratio of phosphorylated synuclein to total synuclein was calculated. Total and p-Ser-129 α-synuclein levels were quantified by sandwich ELISA using 1H7 as the capture antibody and biotinylated 5C12 or biotinylated 11A5 as the total or phosphosynuclein reporter antibodies as described (11) with the exception that cells were lysed in CEB instead of guanidine, and Costar EIA/RIA high binding 96-well plates (Corning) were used.

qRT-PCR Analysis of PLK2 Knock-out Mouse Cortical Cultures—cDNA from mouse cortical culture RNA was made using the SuperScript II first-strand synthesis system from Invitrogen. Gene expression assays from Applied Biosystems containing fluorogenic quantitative PCR primer/probe sets were obtained for mouse PLK2. Each cDNA was added to the qPCR master mix containing Applied Biosystems TaqMan universal PCR master with uracil N-glycosylase and ROX reference dye, 900 nm each of the forward and reverse primer, and 200 nm of the fluorogenic probe. qRT-PCR was carried out using one cycle of 50 °C, 2 min, 95 °C, 2 min and 40 cycles of 95 °C, 15 s and 60 °C, 1 min. For each well, the relative copy number of the gene of interest was normalized to total RNA as measured by the RiboGreen 96-well kit (Invitrogen).

To identify potential α-synuclein kinases, we screened HEK293 cells overexpressing α-synuclein for reduction of the p-Ser-129 modification, using the Ambion Silencer kinase siRNA library (Applied Biosystems). Such knockdown approaches have the advantage of avoiding artificial activity resulting from overexpression. Several kinases whose reduction decreased synuclein phosphorylation were identified (26). Of the candidate kinases, PLK2 was of particular interest because the siRNAs against this enzyme provided the largest and most consistent decrease in α-synuclein phosphorylation. Importantly, PLK2, as well as the closely related PLK3, are expressed in brain (27, 28).

PLK Family Members Directly Phosphorylate α-Synuclein—To confirm that PLK2 can directly phosphorylate α-synuclein, we examined the proteins in vitro. PLK2 was compared with the other members of the PLK family, as well as CK2, which has been previously shown to phosphorylate α-synuclein (10). Phosphorylation at Ser-129 was measured with a fluorescence assay using an antibody specific for phosphorylation at this residue (11); no other phosphorylation was observed by mass spectroscopy. PLK2 and -3 efficiently phosphorylated α-synuclein (Fig. 1A), with results consistent with complete phosphorylation of the 33 nm synuclein substrate (compare with the 33 nm p-Ser-129 (pS129) standard, Fig. 1A, inset). PLK1 had lower activity, comparable with that of CK2. To ensure that all enzymes were active, their abilities to phosphorylate another substrate, casein, were verified (supplemental Fig. S1). PLK4 had no measurable activity against either substrate but was able to autophosphorylate, suggesting that both casein and synuclein may be poor substrates for this enzyme.

FIGURE 1.

Phosphorylation of α-synuclein Ser-129 by PLK2. A, phosphorylation of a biotinylated α-synuclein substrate by recombinant PLK1 (▪), PLK2 (•), PLK3 (⋄), PLK4 (□), and CK2 (○). Phosphorylation of the substrate at Ser-129 was measured using a phosphorylation-specific antibody with the kinase assay described under “Experimental Procedures.” Acceptor/donor ratio (A/D ratio) is a ratio of acceptor and donor fluorescence intensities. Inset, acceptor/donor ratios of the p-Ser-129 (pS129) synuclein standard. B and C, reduction of PLK2 mRNA (B) and p-Ser-129 α-synuclein (C) by lentiviral constructs either containing a scrambled sequence (Control) or expressing PLK2 shRNA, in human cortical cultures overexpressing α-synuclein (E46K mutant). The relative multiplicity of infection (MOI) is shown. **, p < 0.01; ***, p < 0.001. Relative copy numbers (copy#) of PLK2 mRNA were determined by qPCR (“Experimental Procedures”) and normalized to glyceraldehyde-3-phosphate dehydrogenase mRNA. Ratios of p-Ser-129 to total α-synuclein were determined by ELISA.

In this study, we have shown that members of the PLK family, specifically PLK1, -2, and -3, phosphorylate Ser-129 of α-synuclein in vitro, suggesting that they are capable of acting as direct α-synuclein kinases. Studies with inhibitors additionally suggest that PLK2 and PLK3 are responsible for the majority of α-synuclein phosphorylation in cultured neurons and in mouse brain. PLK2-specific shRNA knockdown and genetic deletion of the plk2 gene in mice identify a role for this kinase in particular.

Previous studies of PLK2 have identified several properties that are particularly intriguing for an α-synuclein kinase. It is induced by excitotoxic glutamate agonists (27). Furthermore, Sheng and colleagues have proposed that PLK2 has a critical role in maintaining dendritic spine stability (31) and modulating excitatory glutaminergic synaptic connections (32, 33). Thus, the involvement of PLK2 in α-synuclein phosphorylation provides a potential link between excitotoxic responses and Lewy pathology. Investigation of how the biology of PLK2 relates to the pathogenesis of PD and DLB should help clarify the role of synuclein phosphorylation in these diseases.