All vectors were constructed based on the vector backbone pIRES2-EGFP (BD Biosciences Clontech, Palo Alto, CA, USA; Catalog #6029-1) that contains the immediate early promoter of cytomegalovirus (P_CMV IE) followed by the IRES of the encephalomyocarditis virus (ECMV), an MCS, the enhanced GFP (EGFP) coding sequence and the SV40 polyadenylation signals (SV40pA) downstream of the EGFP.

The vectors were generated as follows. The luciferase coding sequence was amplified from pGL3-basic (Promega) using the forward primer CGCCTCGAGATGGAAGACGCCAAAAACATAAAG containing XhoI restriction site and the backward primer CGCGAATTCTTACACGGCGATCTTTCCGCCCTTC containing EcoRI restriction site. The product was purified, double digested with XhoI and EcoRI and inserted between the XhoI and EcoRI sites of pIRES2-EGFP. This construct was named pLuc-1x(IRES2EGFP)-SV40pA. The construct pLuc-2x(IRES2EGFP)-SV40pA was created as follows: the IRES2EGFP sequence was amplified from pIRES2EGFP plasmid using the forward primer CGCGCGGCCGCCCGCGGGCCCGGGATCCG containing NotI restriction site and the backward primer CGCGCGGCCGCGATATCTTACTTGTACAGCTCGTCCATGCCGAG containing NotI and EcoRV restriction sites. The insertion of the EcoRV restriction site allows cloning of further fragments downstream of IRES2EGFP, as described subsequently. The PCR-product was purified, digested with NotI and inserted into NotI site, between EGFP sequence and SV40pA, of pLuc-1x(IRES2EGFP)-SV40pA. To generate pLuc-3x(IRES2EGFP)-SV40pA, IRES2EGFP sequence was amplified from pIRES2EGFP using the forward primer CGCGATATCCCGCGGGCCCGGGATCCG and the backward primer CGCGATATCTTACTTGTACAGCTCGTCCATGCCGAG, both containing EcoRV restriction sites. The PCR-product was purified, digested with EcoRV and inserted into the created EcoRV site, between the second EGFP sequence and SV40pA, of pLuc-2×(IRES2EGFP)-SV40pA.

To generate the constructs with the interleukin-10 (IL-10)-3′ untranslated region (UTR) instead of SV40pA, we amplified a 832 base pair (bp) long IL-10-fragment located between the 6th and 838th bp behind the stop codon from mouse genomic DNA which enclose the 3′UTR with the forward primer GCGTCTAGAGTGCAGTGTGTATTGAGTCTGCTGG containing XbaI restriction site and the backward primer GCGCTTAAGCCGAGCTCAACCCCTTCCTGGAG containing AflII restriction site. The SV40pA containing sequence was removed from the constructs pLuc-nx(IRES2EGFP)-SV40pA (n = 1, 2 or 3) by digestion with XbaI and AflII restriction sites. The XbaI/AflII IL10-3′UTR fragment was then inserted the XbaI and AflII of the pLuc-nx(IRES2EGFP) constructs. For the generation of the IL10-3′UTR containing constructs, to prevent Dam methylation of the Xba I sites, the constructs passed through a dam⁻E. coli mutant (ATCC 47045).

Prior to transfection, human embryonic kidney (HEK) 293 cell line were seeded in 6-well plates at 5 × 10⁵ cells per well in RPMI 1640 medium with l-glutamine (0.3 g/l), 10% fetal bovine serum (FCS), 10 mM HEPES and penicillin (100 U/ml)–streptomycin (100 μg/ml) (Gibco/Invitrogen). The cells were allowed to attach overnight. A total of 0.9 pmol of each generated construct were transfected separately into HEK 293 using jetPEI™ transfection reagent (Qbiogene Molecular Biology). Selection with G418 (1 mg/ml) was started 48 h after transfection. Transfectants were obtained after 4–6 weeks and maintained under continued selection (0.4–1 mg/ml G418).

Cells were washed twice with phosphate buffered saline (PBS) (Gibco/Invitrogen) and harvested by using 1×trypsin ethylene diamine tetra-acetic acid (trypsin–EDTA) (Gibco/Invitrogen). Equal cell numbers were analysed for EGFP fluorescence by a fluorescence-activated cell sorter (FACS, BD FACSCanto). Background fluorescence was determined using non-transfected cells. A total of 10 000 events were collected using list-mode format for each experiment. Cells were gated on EGFP-expressing population. Data were acquired and analyzed using FlowJo-8.4.6 Software (Tree Star Inc; San Carlos, CA, USA). The mean values (represent the peak integrals) of fluorescence for gated EGFP-expressing populations were determined.

Equal numbers of cells (5–10 × 10⁶) were washed twice in ice-cold PBS, resuspended in lysis-buffer (50 mM Tris–Hcl, pH 7.4; 150 mM NaCl; 1 mM EDTA; 2% chaps or 1% Triton X-100) and incubated on ice for 15–30 min. Cell debris was removed by centrifugation at 14 000g, 4°C for 10 min and the supernatants were transferred into new tubes. The protein concentration was determined by using BCA Protein Assay Kit (Pierce). Equal amounts of protein lysates were subjected to 12% SDS–PAGE under reducing conditions and transferred to nitrocellulose (NC) membrane by semi-dry electroblotting. The NC-membrane was blocked (PBS; 5% dry milk powder; 0.1% Tween-20) for 1–2 h at room temperature and incubated overnight at 4°C with anti-GFP or anti-actin antibodies (Santa Cruz Biotechnology). The antibodies were used in a final concentration of 0.4 µg/ml. Bands were visualized with horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology) and enhanced chemiluminescence substrate. All antibodies were diluted in PBS, 5% FCS and 0.1% Tween-20.

Total RNA was extracted from cells using the RNA MasterPure RNA Purification kit (Biozym). Contaminating genomic DNA was removed by treatment of the RNA preparations with Baseline-Zero DNase (Biozym). mRNA was stored at −80°C. cDNA was generated from total RNA using the RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas), according to manufacturer's instructions. One microgram total RNA was used for each reaction and synthesis was primed by Oligo(dT)₁₈ primers. For negative controls, identical set-ups of reverse transcriptase-polymerase chain reaction (RT-PCR) reactions except reverse transcriptase were performed. This negative control was performed to exclude products amplified from a potential genomic DNA contamination. One microliter of cDNA product was used for a subsequent PCR using 2×BioMix Red (Bioline) in a final volume of 30 μl. The expression level of the multicistronic vectors was detected after 30 amplification cycles using the following primer for luciferase: the forward primer, Luc-F: GGCGCTCCCCTCTCTAAGGA and the backward primer, Luc-B: GGGGTGTTGGAGCAAGATGG. As a loading control, the housekeeping gene, hypoxanthine-guanine-phosphoribosyltransferase (HPRT), was amplified using the primer set: HumHPRT-F: CAGCCCTGGCGTCGTGATTAGTGATG and HumHPRT-B: GGGAACTGATAGTCTATAGGCTCATAGTGC.

Cells were seeded on 6-well plates and cultured until reaching complete confluence (∼5 × 10⁶ cells). Supernatants were then aspirated and 1.5 ml lysis buffer [100 mM Tris–HCl (pH 8.5); 0.2% SDS; 200 mM NaCl; 5 mM EDTA (pH 8.0); 100 μg/ml Proteinase K (freshly added)] was added to each well. After incubation at 37°C for at least 8 h, equal volume (1.5 ml) of isopropanol was added to each well and the plates were incubated on a shaker at 300 r.p.m. and RT for at lest 3 h, until the DNA became visible. DNA were fished with pipette tip, transferred into 150 µl TE-buffer [10 mM Tris–HCl (pH 8); 1 mM EDTA (pH 8)] and incubated at 55°C overnight to allow the dissolution of DNA. The DNA was stored at room temperature (RT) until use. Forty microliter from each DNA sample was digested with 50 U EcoRI (Fermentas) overnight. The digested DNA samples were then fractionated on 0.7 agarose gel in 1×TBE (89 mM Tris–borate, 89 mM boric acid, 2 mM EDTA, pH 8). The gel was treated successively with depurination solution (0.2 M HCl), denaturing buffer (0.5 M NaOH; 1.5 M NaCl) and neutralization buffer (0.5 M Tris–HCl; 1.5 M NaCl; pH 7.2) for ∼45 min, respectively. The gel was subsequently blotted overnight to a positive charged Nylon membrane (Schleicher and Schuell) using 20× SSC (3 M NaCl; 0.3 M tri-Sodium Citrate 2-hydrate; pH 7.2). Cross-linking of the DNA to the membrane was induced by irradiation with a UV lamp for 50 s. The membrane was incubated with hybridization solution [50% Formamide; 5× SSC; 10 mM Tris–HCl (pH 7.5); 1% SDS; 5× Denhardts (2% Ficoll 400; 2% Polyvinylpyrrolidone K30; 2% BSA); 10% Dextransulfate; 100 μg/ml salmon sperm DNA] for 1 h. α³²P-dATP-labeled luciferase probe was then added to the hybridization solution and incubated overnight at 42°C. The luciferase probe was labeled using HexaLabel & trade DNA Labeling Kit (Fermentas) according to manufacturer's instructions. The blot was subsequently washed two times with wash-buffer 1 (2× SSC; 0.1% SDS) for 10 min at RT, then two times with wash buffer 2 (0.5× SSC; 0.4% SDS) for 20 min at 70°C. Radioactive signals were detected with Fuji Film Scanner FLA-3000 and analyzed with Aida Image Analyser v.4.00 software.

Equal numbers of cells were harvested, washed with PBS, resuspended in luciferase-lysis buffer (Luc-Buffer: 80 mM K₂HPO₄; 20 mM KH₂PO₄; 2 mM EDTA; 1% TritonX-100; pH adjusted to 7.8 with 1 M KOH; 1 mM DTT was added freshly before use) and incubated on ice for 15–30 min. Cell debris was removed by centrifugation at 14 000g, 4°C for 10 min and the supernatants were transferred into new tubes. The protein concentration was determined by using BCA Protein Assay Kit (Pierce). Prior to luciferase assay, bovine serum albumin (BSA) was added to a final concentration of 0.5%. The cell lysates were stored at −20°C. Equal amounts of protein lysates (10–60 µg) were transferred into a white microtiter plate (volumes were adjusted to 50–100 µl with Luc-Buffer/0.5% BSA). One volume of Luciferase Assay Reagent (20 mM Tricine; 1.07 mM (MgCO₃)₄Mg(OH)₂.5H₂O; 0.1 mM EDTA; pH adjusted to 7.8 with 1 M HCl; 33.3 mM DTT; 270 µM Li₃-Coenzyme A; 470 µM d-luciferin; 530 µM Mg-ATP) was added to the cell lysate and chemiluminescence was measured immediately with a MicroLumatPlus LB96V microplate luminometer (EG&G Berthold). All experiments were performed independently at least three times.

To test whether an increase in fluorescence output of EGFP can be achieved by expressing EGFP from a multicistronic vector using the IRES of the ECMV in tandem, three constructs, named pLuc-nx(IRES2-EGFP)-SV40-pA (n=1, 2 or 3), were generated which contain one, two or three IRES-EGFP repeats (Figure 1A), respectively and stably expressed in HEK 293 cells. Figure 1.

(A) Schematic representation of the first three constructs used in the studies. The expression vectors were constructed as described in ‘Materials and methods’ section. The EcoRI restriction site and luciferase probe used for Southern blot analysis are shown. The constructs pLuc-nx(IRES2-EGFP)-SV40-pA (n = 1, 2 or 3) were stably transfected in HEK293 cells. (B) Southern blot analysis shows a single insertion of each construct into the genome of the generated three cell lines. (C) The expression level of the multicistronic RNA from the different constructs was analyzed by RT-PCR for luciferase (Luc). (+RT) and (−RT) refer to PCR product from first-strand cDNA synthesis reaction performed from Baseline-Zero DNase-treated total RNA with (+RT) or without (−RT, negative control) reverse transcriptase, respectively. As a loading control, RT-PCR of the housekeeping gene, HPRT, was used. (D) The fluorescence emission of EGFP were analyzed by flow cytometry (using BD FACSCanto). Shown are histograms gated on EGFP-positive cells. The mean values (peak integrals) of fluorescence for the gated EGFP-expressing cells are indicated. (E) Equal amounts of whole cell lysates were separated by SDS–PAGE and the expression level of EGFP were analyzed by western blot using EGFP-antibody. Actin immunostaining is shown as the loading control. (F) Equal amounts of whole cell lysates (10–60 µg) were analyzed for luciferase activity. Control: non transfected HEK293 cells, *, value <50 AU. Experiments were repeated at least three times and similar results were obtained. P_CMV, cytomegalovirus promoter; Luc, luciferase gene; SV40polyA, Simian virus polyadenylation site.

A gene encoding luciferase was inserted right after P_CMV and upstream of the first IRES into the three constructs (pLuc-nx(IRES2-EGFP)-SV40-pA; Figure 1A) in order to quantitatively analyze cap-dependent gene expression. If the IRES-dependent translations would interfere with the cap-dependent translation, the luciferase activity should be reciprocated proportional to the number of inserted IRES-EGFP repeats. Equal amounts of whole cell lysates from the three cell lines were collected and analysed for luciferase activity. Interestingly, the luciferase reporter activities were similar for the three different constructs (Figure 1F) indicating that multiple tandem-IRES do not interfere with cap-dependent gene expression. Since the cap-dependent luciferase activity is not affected by the number of IRESs, it can be used as an internal normalization control to eliminate experimental variability, including variations in transfection efficiency.

The ‘adenylate/uridylate (AU)-rich elements’ (AREs) are well-known RNA sequences in 3′UTRs, which regulate the stability of the mRNA and hence the expression level of the corresponding protein (26). We therefore asked whether the presence of several exogenous IRES sequences in the 3′ region of mRNA would interfere with the 3′UTR function.

To test this, we replaced the RNA-stabilizing SV-40polyA by the IL-10-3′UTR of the pLuc-nx(IRES2-EGFP)-SV40-pA constructs (Figure 2A). IL-10-3′UTR is known to accelerate the degradation of IL-10-mRNA (27). We used a 832 bp long mouse IL-10-fragment spanning the 6th and 838th bp downstream of the stop codon, which include the 3′UTR sequence. Figure 2.

(A) Schematic representation of the pLuc-nx(IRES2-EGFP)-IL10-3′UTR constructs (n = 1, 2 or 3). The expression vectors were constructed as described in ‘Materials and methods'section. The EcoRI restriction site and luciferase probe used for Southern blot analysis are shown. The constructs were stably transfected in HEK293 cells. (B) Southern blot analysis shows a single insertion of each construct into the genome of the generated three cell lines. (C) Comparison of the fluorescence emission of EGFP between SV40polyA and IL10-3′UTR-containing constructs were determined by flow cytometry. Shown are histograms gated on EGFP-positive cells. The mean values (peak integrals) of fluorescence for the gated EGFP-expressing cells are indicated. (D) Equal amounts of whole cell lysates from all six cell lines expressing the indicated construct were analyzed for luciferase activity. Control, nontransfected HEK293 cells; *, value <15 AU. P_CMV, cytomegalovirus promoter; SV40polyA, Simian virus polyadenylation site.

With the pLuc-nx(IRES2-EGFP)-SV40-polyA constructs the increase in fluorescence output was proportional to the number of IRES-EGFP repeats (Figure 1D). We wondered whether similar result can be reached with the IL10-3′UTR containing constructs, which show an altered expression regulation compared to SV40polyA containing constructs (Figure 2).

The analysis of mRNA expression by RT-PCR showed no significant difference in the expression level of the three different constructs (Figure 3A). Furthermore, the Southern blot analysis showed a single insertion of each construct into the genome of the pLuc-nx(IRES2-EGFP)-IL10-3′UTR expressing cell lines (Figure 2B). Thus, the fluorescence output of EGFP will be dependent on the number of IRES-EGFP repeats and on their translation efficiency and not on different genomic integration efficiency. Figure 3.

Stably transfected HEK293 cells with the constructs pLuc-nx(IRES2-EGFP)-IL10-3′UTR, containing one (n = 1), two (n = 2) or three (n = 3) IRES-EGFP repeats were established and (A) The expression level of the multicistronic RNA from the different constructs was analyzed by RT-PCR. (+RT) and (−RT) refer to PCR product from first-strand cDNA synthesis reaction performed from Baseline-Zero DNase-treated total RNA with (+RT) or without (−RT, negative control) reverse transcriptase (RT), respectively. As a loading control, RT-PCR of the housekeeping gene, HPRT, was used. (B) The fluorescence emission of EGFP from the three cell lines were analyzed by flow cytometry. Shown are histograms gated on EGFP-positive cells. The mean values (peak integrals) of fluorescence for the gated EGFP-expressing cells are indicated. (C) Equal amounts of whole cell lysates were separated by SDS–PAGE and the expression level of EGFP were analyzed by western blot using EGFP-antibody. Actin immunostaining is shown as the loading control. (D) Equal amounts of whole cell lysates from all three cell lines were analyzed for luciferase activity. Control, nontransfected HEK293 cells; *, value <15 AU.